ID: 909238359

View in Genome Browser
Species Human (GRCh38)
Location 1:73180995-73181017
Sequence CCTCAGTCCTCTCCAGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909238359_909238367 30 Left 909238359 1:73180995-73181017 CCAAATTCTGGAGAGGACTGAGG No data
Right 909238367 1:73181048-73181070 TGAGCTTACTCACACCTAGCTGG No data
909238359_909238364 -9 Left 909238359 1:73180995-73181017 CCAAATTCTGGAGAGGACTGAGG No data
Right 909238364 1:73181009-73181031 GGACTGAGGTTTACGGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909238359 Original CRISPR CCTCAGTCCTCTCCAGAATT TGG (reversed) Intergenic
No off target data available for this crispr