ID: 909238360

View in Genome Browser
Species Human (GRCh38)
Location 1:73180995-73181017
Sequence CCAAATTCTGGAGAGGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909238352_909238360 -2 Left 909238352 1:73180974-73180996 CCCCTCTCATGTTCCTTGGGCCC No data
Right 909238360 1:73180995-73181017 CCAAATTCTGGAGAGGACTGAGG No data
909238348_909238360 17 Left 909238348 1:73180955-73180977 CCTCAGACTCCTTCAGCTTCCCC No data
Right 909238360 1:73180995-73181017 CCAAATTCTGGAGAGGACTGAGG No data
909238354_909238360 -4 Left 909238354 1:73180976-73180998 CCTCTCATGTTCCTTGGGCCCAA No data
Right 909238360 1:73180995-73181017 CCAAATTCTGGAGAGGACTGAGG No data
909238349_909238360 8 Left 909238349 1:73180964-73180986 CCTTCAGCTTCCCCTCTCATGTT No data
Right 909238360 1:73180995-73181017 CCAAATTCTGGAGAGGACTGAGG No data
909238353_909238360 -3 Left 909238353 1:73180975-73180997 CCCTCTCATGTTCCTTGGGCCCA No data
Right 909238360 1:73180995-73181017 CCAAATTCTGGAGAGGACTGAGG No data
909238347_909238360 18 Left 909238347 1:73180954-73180976 CCCTCAGACTCCTTCAGCTTCCC No data
Right 909238360 1:73180995-73181017 CCAAATTCTGGAGAGGACTGAGG No data
909238346_909238360 21 Left 909238346 1:73180951-73180973 CCTCCCTCAGACTCCTTCAGCTT No data
Right 909238360 1:73180995-73181017 CCAAATTCTGGAGAGGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909238360 Original CRISPR CCAAATTCTGGAGAGGACTG AGG Intergenic
No off target data available for this crispr