ID: 909238362

View in Genome Browser
Species Human (GRCh38)
Location 1:73181003-73181025
Sequence TGGAGAGGACTGAGGTTTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909238349_909238362 16 Left 909238349 1:73180964-73180986 CCTTCAGCTTCCCCTCTCATGTT No data
Right 909238362 1:73181003-73181025 TGGAGAGGACTGAGGTTTACGGG No data
909238347_909238362 26 Left 909238347 1:73180954-73180976 CCCTCAGACTCCTTCAGCTTCCC No data
Right 909238362 1:73181003-73181025 TGGAGAGGACTGAGGTTTACGGG No data
909238346_909238362 29 Left 909238346 1:73180951-73180973 CCTCCCTCAGACTCCTTCAGCTT No data
Right 909238362 1:73181003-73181025 TGGAGAGGACTGAGGTTTACGGG No data
909238356_909238362 -7 Left 909238356 1:73180987-73181009 CCTTGGGCCCAAATTCTGGAGAG No data
Right 909238362 1:73181003-73181025 TGGAGAGGACTGAGGTTTACGGG No data
909238352_909238362 6 Left 909238352 1:73180974-73180996 CCCCTCTCATGTTCCTTGGGCCC No data
Right 909238362 1:73181003-73181025 TGGAGAGGACTGAGGTTTACGGG No data
909238354_909238362 4 Left 909238354 1:73180976-73180998 CCTCTCATGTTCCTTGGGCCCAA No data
Right 909238362 1:73181003-73181025 TGGAGAGGACTGAGGTTTACGGG No data
909238348_909238362 25 Left 909238348 1:73180955-73180977 CCTCAGACTCCTTCAGCTTCCCC No data
Right 909238362 1:73181003-73181025 TGGAGAGGACTGAGGTTTACGGG No data
909238353_909238362 5 Left 909238353 1:73180975-73180997 CCCTCTCATGTTCCTTGGGCCCA No data
Right 909238362 1:73181003-73181025 TGGAGAGGACTGAGGTTTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909238362 Original CRISPR TGGAGAGGACTGAGGTTTAC GGG Intergenic
No off target data available for this crispr