ID: 909238364

View in Genome Browser
Species Human (GRCh38)
Location 1:73181009-73181031
Sequence GGACTGAGGTTTACGGGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909238358_909238364 -8 Left 909238358 1:73180994-73181016 CCCAAATTCTGGAGAGGACTGAG No data
Right 909238364 1:73181009-73181031 GGACTGAGGTTTACGGGGATTGG No data
909238354_909238364 10 Left 909238354 1:73180976-73180998 CCTCTCATGTTCCTTGGGCCCAA No data
Right 909238364 1:73181009-73181031 GGACTGAGGTTTACGGGGATTGG No data
909238352_909238364 12 Left 909238352 1:73180974-73180996 CCCCTCTCATGTTCCTTGGGCCC No data
Right 909238364 1:73181009-73181031 GGACTGAGGTTTACGGGGATTGG No data
909238349_909238364 22 Left 909238349 1:73180964-73180986 CCTTCAGCTTCCCCTCTCATGTT No data
Right 909238364 1:73181009-73181031 GGACTGAGGTTTACGGGGATTGG No data
909238359_909238364 -9 Left 909238359 1:73180995-73181017 CCAAATTCTGGAGAGGACTGAGG No data
Right 909238364 1:73181009-73181031 GGACTGAGGTTTACGGGGATTGG No data
909238356_909238364 -1 Left 909238356 1:73180987-73181009 CCTTGGGCCCAAATTCTGGAGAG No data
Right 909238364 1:73181009-73181031 GGACTGAGGTTTACGGGGATTGG No data
909238353_909238364 11 Left 909238353 1:73180975-73180997 CCCTCTCATGTTCCTTGGGCCCA No data
Right 909238364 1:73181009-73181031 GGACTGAGGTTTACGGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909238364 Original CRISPR GGACTGAGGTTTACGGGGAT TGG Intergenic
No off target data available for this crispr