ID: 909238367

View in Genome Browser
Species Human (GRCh38)
Location 1:73181048-73181070
Sequence TGAGCTTACTCACACCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909238359_909238367 30 Left 909238359 1:73180995-73181017 CCAAATTCTGGAGAGGACTGAGG No data
Right 909238367 1:73181048-73181070 TGAGCTTACTCACACCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909238367 Original CRISPR TGAGCTTACTCACACCTAGC TGG Intergenic
No off target data available for this crispr