ID: 909241254

View in Genome Browser
Species Human (GRCh38)
Location 1:73216803-73216825
Sequence TGTAAGTATGAAATCTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909241254_909241260 -9 Left 909241254 1:73216803-73216825 CCCCCCAAGATTTCATACTTACA No data
Right 909241260 1:73216817-73216839 ATACTTACAGTCTCTATGTAGGG No data
909241254_909241259 -10 Left 909241254 1:73216803-73216825 CCCCCCAAGATTTCATACTTACA No data
Right 909241259 1:73216816-73216838 CATACTTACAGTCTCTATGTAGG No data
909241254_909241262 28 Left 909241254 1:73216803-73216825 CCCCCCAAGATTTCATACTTACA No data
Right 909241262 1:73216854-73216876 AATATATTTATGAGAATCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909241254 Original CRISPR TGTAAGTATGAAATCTTGGG GGG (reversed) Intergenic
No off target data available for this crispr