ID: 909242156

View in Genome Browser
Species Human (GRCh38)
Location 1:73227597-73227619
Sequence ATGTATATCAATCAGCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909242153_909242156 16 Left 909242153 1:73227558-73227580 CCAAAACTTTGTGAAGCTGGATA No data
Right 909242156 1:73227597-73227619 ATGTATATCAATCAGCATGATGG No data
909242155_909242156 -10 Left 909242155 1:73227584-73227606 CCAAAGATGGAAAATGTATATCA No data
Right 909242156 1:73227597-73227619 ATGTATATCAATCAGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909242156 Original CRISPR ATGTATATCAATCAGCATGA TGG Intergenic
No off target data available for this crispr