ID: 909244167

View in Genome Browser
Species Human (GRCh38)
Location 1:73255934-73255956
Sequence TTTTACATGCAGAAGCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909244165_909244167 15 Left 909244165 1:73255896-73255918 CCAATGTGTTCTGCTGTATTACA No data
Right 909244167 1:73255934-73255956 TTTTACATGCAGAAGCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909244167 Original CRISPR TTTTACATGCAGAAGCTGAA AGG Intergenic
No off target data available for this crispr