ID: 909251614

View in Genome Browser
Species Human (GRCh38)
Location 1:73364145-73364167
Sequence GTGGTTGCCCTGAGGATGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909251614_909251620 29 Left 909251614 1:73364145-73364167 CCCCTCATCCTCAGGGCAACCAC No data
Right 909251620 1:73364197-73364219 TCTTGACATGAGCAACAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909251614 Original CRISPR GTGGTTGCCCTGAGGATGAG GGG (reversed) Intergenic
No off target data available for this crispr