ID: 909261623

View in Genome Browser
Species Human (GRCh38)
Location 1:73496603-73496625
Sequence TCTTACCTAGGGATGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909261623_909261627 -5 Left 909261623 1:73496603-73496625 CCATGCACCATCCCTAGGTAAGA No data
Right 909261627 1:73496621-73496643 TAAGACTTTAGCTGTTGTTCTGG No data
909261623_909261628 0 Left 909261623 1:73496603-73496625 CCATGCACCATCCCTAGGTAAGA No data
Right 909261628 1:73496626-73496648 CTTTAGCTGTTGTTCTGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909261623 Original CRISPR TCTTACCTAGGGATGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr