ID: 909266453

View in Genome Browser
Species Human (GRCh38)
Location 1:73564833-73564855
Sequence GTGGAAACTCACTGCCAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909266450_909266453 -10 Left 909266450 1:73564820-73564842 CCTGTGTGCACCGGTGGAAACTC No data
Right 909266453 1:73564833-73564855 GTGGAAACTCACTGCCAGTTGGG No data
909266447_909266453 4 Left 909266447 1:73564806-73564828 CCTCAAATCTACAACCTGTGTGC No data
Right 909266453 1:73564833-73564855 GTGGAAACTCACTGCCAGTTGGG No data
909266446_909266453 5 Left 909266446 1:73564805-73564827 CCCTCAAATCTACAACCTGTGTG No data
Right 909266453 1:73564833-73564855 GTGGAAACTCACTGCCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909266453 Original CRISPR GTGGAAACTCACTGCCAGTT GGG Intergenic
No off target data available for this crispr