ID: 909268391

View in Genome Browser
Species Human (GRCh38)
Location 1:73591758-73591780
Sequence CCAACTTGGAAGCAGAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909268380_909268391 28 Left 909268380 1:73591707-73591729 CCATGTGAAGAACAGTGTTTCTA No data
Right 909268391 1:73591758-73591780 CCAACTTGGAAGCAGAGACCAGG No data
909268386_909268391 1 Left 909268386 1:73591734-73591756 CCAGGGAATTTACCCTCTAAGGC No data
Right 909268391 1:73591758-73591780 CCAACTTGGAAGCAGAGACCAGG No data
909268384_909268391 4 Left 909268384 1:73591731-73591753 CCTCCAGGGAATTTACCCTCTAA No data
Right 909268391 1:73591758-73591780 CCAACTTGGAAGCAGAGACCAGG No data
909268383_909268391 5 Left 909268383 1:73591730-73591752 CCCTCCAGGGAATTTACCCTCTA No data
Right 909268391 1:73591758-73591780 CCAACTTGGAAGCAGAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909268391 Original CRISPR CCAACTTGGAAGCAGAGACC AGG Intergenic
No off target data available for this crispr