ID: 909281389

View in Genome Browser
Species Human (GRCh38)
Location 1:73758914-73758936
Sequence ATCTGGTGTTAAGATTATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909281386_909281389 21 Left 909281386 1:73758870-73758892 CCATATGGCAATAGATACTTTAA No data
Right 909281389 1:73758914-73758936 ATCTGGTGTTAAGATTATTATGG No data
909281388_909281389 -10 Left 909281388 1:73758901-73758923 CCAAAATGCAAGAATCTGGTGTT No data
Right 909281389 1:73758914-73758936 ATCTGGTGTTAAGATTATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909281389 Original CRISPR ATCTGGTGTTAAGATTATTA TGG Intergenic
No off target data available for this crispr