ID: 909284762

View in Genome Browser
Species Human (GRCh38)
Location 1:73801753-73801775
Sequence CAGAATGGCTTTTTTTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909284762_909284765 13 Left 909284762 1:73801753-73801775 CCAAAAAAAAAAAAGCCATTCTG No data
Right 909284765 1:73801789-73801811 CCCATGTTTATATCAAAGCCAGG No data
909284762_909284767 14 Left 909284762 1:73801753-73801775 CCAAAAAAAAAAAAGCCATTCTG No data
Right 909284767 1:73801790-73801812 CCATGTTTATATCAAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909284762 Original CRISPR CAGAATGGCTTTTTTTTTTT TGG (reversed) Intergenic