ID: 909284765

View in Genome Browser
Species Human (GRCh38)
Location 1:73801789-73801811
Sequence CCCATGTTTATATCAAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909284763_909284765 -2 Left 909284763 1:73801768-73801790 CCATTCTGTTATTGAGTTAAACC No data
Right 909284765 1:73801789-73801811 CCCATGTTTATATCAAAGCCAGG No data
909284762_909284765 13 Left 909284762 1:73801753-73801775 CCAAAAAAAAAAAAGCCATTCTG No data
Right 909284765 1:73801789-73801811 CCCATGTTTATATCAAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909284765 Original CRISPR CCCATGTTTATATCAAAGCC AGG Intergenic