ID: 909285529

View in Genome Browser
Species Human (GRCh38)
Location 1:73811867-73811889
Sequence CACCTATCAATGCATTACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909285529_909285530 -7 Left 909285529 1:73811867-73811889 CCTAGGTAATGCATTGATAGGTG No data
Right 909285530 1:73811883-73811905 ATAGGTGCAGAAAACCACCATGG 0: 38
1: 2992
2: 7262
3: 7434
4: 18293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909285529 Original CRISPR CACCTATCAATGCATTACCT AGG (reversed) Intergenic
No off target data available for this crispr