ID: 909290558

View in Genome Browser
Species Human (GRCh38)
Location 1:73878052-73878074
Sequence CAGGCAGAGCTGACTATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909290552_909290558 13 Left 909290552 1:73878016-73878038 CCTCACATTCTGGCTATCTTCAC No data
Right 909290558 1:73878052-73878074 CAGGCAGAGCTGACTATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909290558 Original CRISPR CAGGCAGAGCTGACTATGGA AGG Intergenic
No off target data available for this crispr