ID: 909291665

View in Genome Browser
Species Human (GRCh38)
Location 1:73890724-73890746
Sequence GGTGTATTGTTACAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909291665_909291668 -2 Left 909291665 1:73890724-73890746 CCTGTTTTTTGTAACAATACACC No data
Right 909291668 1:73890745-73890767 CCAATCAGAAGATTTTGTTTGGG No data
909291665_909291669 25 Left 909291665 1:73890724-73890746 CCTGTTTTTTGTAACAATACACC No data
Right 909291669 1:73890772-73890794 TATTAATGTGACCAATCTAATGG No data
909291665_909291666 -3 Left 909291665 1:73890724-73890746 CCTGTTTTTTGTAACAATACACC No data
Right 909291666 1:73890744-73890766 ACCAATCAGAAGATTTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909291665 Original CRISPR GGTGTATTGTTACAAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr