ID: 909302733

View in Genome Browser
Species Human (GRCh38)
Location 1:74033866-74033888
Sequence CAGGGTGTCCATTTTGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909302733 Original CRISPR CAGGGTGTCCATTTTGAAGT AGG (reversed) Intronic
902571302 1:17348511-17348533 CAGGCTGTCCATGTGGAGGTGGG + Intronic
906939559 1:50244370-50244392 CAAGGTGATCATTTTGAAATGGG - Intergenic
907537743 1:55180334-55180356 CATGGTGTCCATGTTGCAGGAGG - Intronic
907581559 1:55576863-55576885 GAAGGTGTTAATTTTGAAGTGGG - Intergenic
909302733 1:74033866-74033888 CAGGGTGTCCATTTTGAAGTAGG - Intronic
910274876 1:85438294-85438316 CAGGGGGTCCATGTTCAGGTTGG - Intronic
910320952 1:85943298-85943320 CAGGGTCTCCAGTTTGCAGATGG + Intronic
910454617 1:87384150-87384172 CAGGGTCTACATTTAGAAGCAGG + Intergenic
911089041 1:94002758-94002780 CAGGGTTTGCATTTTGAGGTAGG - Intronic
911999629 1:104815141-104815163 AAGCATGTCCATTTTGCAGTTGG - Intergenic
914436974 1:147669431-147669453 CTGTGTGACCATTTTGAAGGTGG - Intronic
916635327 1:166662006-166662028 CAGGGTCTCCATCTTGCAGATGG + Intergenic
916720493 1:167481838-167481860 CAGTGTGTCCCCTTTGAAATGGG - Intronic
918012779 1:180603265-180603287 CAGGCTGCCCATTTTCCAGTGGG + Intergenic
919668216 1:200313315-200313337 AAGGCATTCCATTTTGAAGTAGG - Intergenic
921508745 1:216006590-216006612 CAGGTTTTCCAGTTTGAACTGGG + Intronic
923510204 1:234644659-234644681 CATGCTCTCCAATTTGAAGTGGG + Intergenic
923991866 1:239446801-239446823 CAAAGTATCCATTTAGAAGTGGG + Intronic
924580231 1:245317125-245317147 CAGGATGTCTATTTTTAAGCAGG - Intronic
1064429637 10:15259736-15259758 CAGGGCATCTATTTTGAGGTAGG - Intronic
1065492828 10:26299347-26299369 CATGGTCTCCATTTTGAACCGGG + Intronic
1065549832 10:26860012-26860034 CTGCTTGTCCATTTTCAAGTCGG - Intronic
1065594003 10:27294691-27294713 CTGGGAGTCCCTTCTGAAGTTGG - Intergenic
1066263546 10:33752687-33752709 CAGGCTTTCCATCTTGAAGAGGG - Intergenic
1068513607 10:57997583-57997605 TAGGGTGTCCATTCAGTAGTGGG - Intergenic
1069644122 10:69979725-69979747 CAGTGTGTCCAGCTTGAAGATGG - Intergenic
1070403410 10:76073680-76073702 CAGGGTGCCATTTTTCAAGTTGG + Intronic
1070842450 10:79496695-79496717 CAGAGTGTCCATCTTTAAGGAGG - Intergenic
1073604571 10:104880836-104880858 CAAGCTATCCATTTTGCAGTGGG + Intronic
1073854455 10:107658783-107658805 CAGGGTGTCCTTTGTGAAGAAGG - Intergenic
1076615163 10:131750110-131750132 CCGGGTGTCCACTTTCAAGGAGG - Intergenic
1076869248 10:133185496-133185518 CAGTGTGTGCAGTGTGAAGTAGG + Intronic
1077670478 11:4152825-4152847 CTGGGCGTCCAATTTGAAGGAGG + Intergenic
1080096840 11:28418423-28418445 CAGTGGGTCTATTTTGAAGATGG + Intergenic
1081408400 11:42725530-42725552 CAAGGTGGCCATTATGAGGTAGG - Intergenic
1083438114 11:62657019-62657041 AAGGGTGTTCATTTTGGAGTTGG + Intronic
1084299545 11:68238167-68238189 CAAGGTTTCCACTCTGAAGTTGG - Intergenic
1087321674 11:96668268-96668290 CAGGTTGTCCATTTAGAGTTGGG + Intergenic
1088823823 11:113477149-113477171 CAGTTTCTCCATTTTTAAGTGGG + Intergenic
1091965323 12:4735780-4735802 CAGGGTGTCATTCTAGAAGTGGG + Intronic
1094266792 12:28568738-28568760 CAGGGTCTCCATTTTTAAGGAGG - Intronic
1099028634 12:77496784-77496806 CAGGGTCTTCATTTTGCACTGGG - Intergenic
1100199137 12:92279651-92279673 AAGAGGGTCCATTTTGAAGCAGG - Intergenic
1100206445 12:92354826-92354848 CAGTGTGGTCATTTTGAAATGGG - Intergenic
1101437610 12:104677591-104677613 CAGGGTGTCCATTTGAAAGTGGG + Intronic
1101837161 12:108303722-108303744 CAGGGTGTGCATTTTACAGACGG + Intronic
1106776473 13:33015323-33015345 CACAGTGTCCATTTGGATGTGGG - Intergenic
1107823943 13:44310758-44310780 CAGGGTGCCCATTTGGGACTGGG - Intergenic
1109142556 13:58733435-58733457 CAGGGTCTCCAGTTTGCAGATGG - Intergenic
1109272411 13:60269022-60269044 CAGAGTAGCCATTTTGCAGTAGG + Intergenic
1110739025 13:78972734-78972756 CATGGTGTCCATTTCAAAGATGG - Intergenic
1111123094 13:83879647-83879669 CAGGGTGTCCATCTCGGTGTTGG - Exonic
1121106318 14:91282142-91282164 CAGGGTCTCCATTTTGGAGATGG + Intronic
1122429154 14:101628993-101629015 CAGGGTGGCCATCATGGAGTGGG + Intergenic
1124870480 15:33536608-33536630 AAGGGTGTCCATGATGAAGGGGG - Intronic
1126866530 15:52943056-52943078 CAGGCTGACATTTTTGAAGTAGG + Intergenic
1127879370 15:63142943-63142965 CTGGGTGTCAACTTGGAAGTTGG + Intronic
1130796859 15:87218762-87218784 CAGGGTCCCCAGTTTGAAATTGG + Intergenic
1132560739 16:592456-592478 CTCTGTGTCCATTTTGAGGTGGG + Intronic
1135190076 16:20347690-20347712 CAGGGTGCCAATTGTAAAGTTGG + Intronic
1137532637 16:49290608-49290630 CAGAGAGTCCATTTTAAAATAGG - Intergenic
1138022324 16:53495928-53495950 CAGGGTGTCCATTTGAGAGCAGG - Intronic
1139721749 16:68861712-68861734 CTGGGTGTACATTATGAAGCTGG + Intronic
1139948754 16:70659165-70659187 CAGGGTGTCCAGCTTCAAGCTGG - Intronic
1141498366 16:84426013-84426035 CAGGGTGTCCCTTTTGTATTAGG + Intronic
1141668441 16:85478567-85478589 CAGTGTGTCCATTCTTCAGTTGG + Intergenic
1142217038 16:88834862-88834884 CAGGGTGTCCCTGCTGAGGTGGG - Intronic
1142780956 17:2180777-2180799 CAGAGGGACCATTTGGAAGTGGG + Intronic
1146178961 17:30685157-30685179 CAGGGTGACCCTTCTGAAGGGGG + Intergenic
1146181916 17:30703895-30703917 CAGGGGGTATATTTTGAAGGTGG - Intergenic
1146559415 17:33855240-33855262 CAGGGTCTCCAGTCTGGAGTTGG - Intronic
1148337788 17:46852671-46852693 CAGGCTGTACATATTGGAGTTGG - Intronic
1150523008 17:65889236-65889258 CAGGGAGTCCATTTTAGAGGTGG - Intronic
1150846145 17:68660034-68660056 CAGGCTTTCCATTCTGAACTAGG - Intergenic
1150910886 17:69386398-69386420 CAGAGAGTGCATTTTGAAATAGG + Intergenic
1160018884 18:75165217-75165239 CTGGGTGTCCTTTATGAACTGGG + Intergenic
1161697387 19:5777085-5777107 CAGTGTGTCCCTTTGGAAGGGGG + Intronic
1162976922 19:14211896-14211918 CAGGGGGTATATTTTGAAGGTGG + Intergenic
1162979652 19:14230397-14230419 CAGGGTGACCCTTCTGAAGGGGG - Intergenic
1163756036 19:19106598-19106620 AAGGGTCTTCATTTTGAACTGGG + Intronic
1166594860 19:44036592-44036614 CAAGGTTTCCATTATGAATTGGG + Intergenic
926069370 2:9873217-9873239 CAGGGTGTTTATATTGTAGTAGG + Intronic
926742108 2:16120511-16120533 CAGGTTCGCAATTTTGAAGTTGG + Intergenic
927962576 2:27250178-27250200 CAGGGTGTTCCTTTTATAGTTGG - Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
932011694 2:67984240-67984262 CAGGGTCTCCATGGTGCAGTAGG + Intergenic
935155455 2:100480208-100480230 CAATGTGCCCATTTCGAAGTTGG + Intronic
936799197 2:116245665-116245687 CAAAGTATACATTTTGAAGTAGG - Intergenic
937128373 2:119488829-119488851 CAATGTGCCCATTTTAAAGTGGG - Intronic
937225365 2:120365777-120365799 CAAGGTGTCCGTTCTGTAGTAGG + Intergenic
938775453 2:134537603-134537625 CTGGGTGTCTATTATGAACTGGG - Intronic
938900760 2:135796912-135796934 CAGGGTGTGCATTGTGAGGTGGG + Intronic
941111946 2:161425959-161425981 CAGGCTGCCCATATTGGAGTGGG - Intronic
941401185 2:165032826-165032848 CAGGGTCTCCTGTTTGAACTGGG + Intergenic
947541570 2:230983552-230983574 CCCTGTGTCCATTTGGAAGTGGG - Intergenic
1170871173 20:20208106-20208128 CATCGTCTCCATTTTGCAGTGGG + Intronic
1171213352 20:23334101-23334123 CAGGGAGTCCATTCTTAGGTCGG + Intergenic
1171213370 20:23334241-23334263 CAGGGAGTTCATTCTGAGGTCGG + Intergenic
1172873350 20:38149244-38149266 CAGGGGGTACTTCTTGAAGTAGG - Intronic
1172876876 20:38169771-38169793 CAGCGTGTCCACTTTGCAGATGG + Intergenic
1177228263 21:18285298-18285320 CAGGATGTCCATTTGTAAGTGGG + Intronic
1179511029 21:41873742-41873764 CAGAGTTTCCATTTTTAAGATGG - Intronic
1183650646 22:39151747-39151769 CAGGGTGTATGTTTTGAAGAAGG + Intronic
949498262 3:4654117-4654139 CGGGGTCTCCATTTCTAAGTTGG + Intronic
949879493 3:8650163-8650185 CAGGGTGTTCAATTTTAAATAGG - Intronic
951174195 3:19580002-19580024 CGTGGTGTCAATTTTGAAGTTGG + Intergenic
951364409 3:21763207-21763229 CAGGGTGTCCATTTAAATCTTGG - Intronic
953412603 3:42698720-42698742 TAGGGGGTCCATCTTGAAGGAGG + Exonic
957609553 3:82449489-82449511 CAGTTTATCCCTTTTGAAGTGGG + Intergenic
962032357 3:131614570-131614592 TAGGGAGTCGTTTTTGAAGTAGG + Intronic
964159173 3:153625876-153625898 CAGTTTGTCTACTTTGAAGTAGG - Intergenic
966572489 3:181461199-181461221 CGGTGTGTGGATTTTGAAGTGGG + Intergenic
967813269 3:193778621-193778643 CAGCGTGTCCATCTTGCAGAGGG + Intergenic
968261531 3:197328751-197328773 CAAAGTGTCCATTTTGAAAGCGG - Intergenic
969241499 4:5901666-5901688 CAGGGTGTCCTGTGTGCAGTGGG + Intronic
969469579 4:7379599-7379621 ATGGGTGTCCATTTTGCAGATGG + Intronic
972163658 4:36256482-36256504 CAGGCTTTCCAATTTAAAGTAGG - Intergenic
972272539 4:37524968-37524990 CAGGGTGTCCAGATTTAAGATGG + Intronic
972999515 4:44928424-44928446 CAGGATGGCCATTATGGAGTTGG + Intergenic
973840781 4:54858271-54858293 CAGCGTTTCTCTTTTGAAGTTGG - Intergenic
975348211 4:73318418-73318440 CAGGGCATCCATTTTGCTGTGGG - Intergenic
976194232 4:82517736-82517758 CAGGGTCTCCATCTTGCAGATGG + Intronic
977475908 4:97509144-97509166 CAGGGTTTCGATTTTGAACCTGG + Intronic
985909227 5:2866007-2866029 CAGGGTCTCAGTTTTGAGGTTGG - Intergenic
986466820 5:8034332-8034354 CAGGGGGTCCATCTGGAATTCGG - Intergenic
987453543 5:18115879-18115901 CAGGGAGTCTATTTTGACCTGGG + Intergenic
987766549 5:22238810-22238832 CATCTTGTCCATTTTGAGGTTGG + Intronic
988033969 5:25801641-25801663 CATGCTTTCCATTTTGAAATCGG + Intergenic
988196485 5:28012087-28012109 GAGGGTTTCCAGTTTGCAGTGGG - Intergenic
994330877 5:98504736-98504758 CAAGGTGTTCTTTTTGCAGTTGG - Intergenic
995518322 5:112976249-112976271 GAGGGTATCCATTTTGGAGGTGG - Intergenic
998582328 5:143390670-143390692 CAGGGTGACTATTCTGAAATGGG - Intronic
999689558 5:154134942-154134964 AAGGTTGTCCATTATAAAGTGGG + Intronic
1000126265 5:158246820-158246842 CAAGCTGCCCATTTTGAATTTGG + Intergenic
1000158073 5:158571549-158571571 CAGGGTGACCAGTTTGAACATGG - Intergenic
1000233083 5:159333297-159333319 CAGGGTCTGGATTGTGAAGTGGG - Intergenic
1003881919 6:10486879-10486901 CATGGTTTCATTTTTGAAGTCGG - Intergenic
1004679794 6:17882186-17882208 CAGATTGACCATTTTGCAGTTGG - Intronic
1007200918 6:40108464-40108486 CAATGTTTCCATTTTGAAATAGG + Intergenic
1007460533 6:42015203-42015225 AAGGGTGTCCATTCTGGAGCTGG - Intronic
1010662955 6:78592630-78592652 CTGGGTCTCCAGTTTGAAGATGG - Intergenic
1013758572 6:113489306-113489328 CAGGGAGTTCATTTTAAAGAAGG - Intergenic
1015280891 6:131433081-131433103 CAGGGTGTCCATTCTAAAGATGG - Intergenic
1016961869 6:149681096-149681118 CAGGTTGTTCTTTTCGAAGTAGG - Intronic
1017899980 6:158711452-158711474 CAGGGTCTCCAGTTTGCAGATGG - Intronic
1018577327 6:165273370-165273392 CATCATGTACATTTTGAAGTTGG + Intergenic
1021297508 7:18926402-18926424 CTGTGTATCCATTTTGCAGTTGG + Intronic
1021818050 7:24467391-24467413 CAGGGTGCCCATTTTAGAGATGG + Intergenic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1023776868 7:43616353-43616375 CAGGGTGTCTATTTTGTGTTAGG - Intronic
1026391311 7:69905420-69905442 CAGGGTCTCCATCTTGCAGATGG - Intronic
1027564818 7:79778441-79778463 CATGATGTCCATGTTGCAGTTGG + Intergenic
1033724659 7:144101722-144101744 AAGTGAGTCAATTTTGAAGTAGG - Intergenic
1035915417 8:3615588-3615610 TAGTGTGTCTATATTGAAGTTGG - Intronic
1036766652 8:11553757-11553779 CTGGGTGTCCTTTTGCAAGTAGG + Intronic
1037548960 8:19951223-19951245 CAGGGTTCCCATTGTGAAGTAGG + Intronic
1040464426 8:47680615-47680637 AAGGGTGGCCTTTTTGAAGAAGG - Intronic
1040897861 8:52388005-52388027 CAGGGTGTCCGCTTTGAGGGGGG + Intronic
1044309595 8:90678388-90678410 TTGAGTGTCCATTTTGAGGTTGG - Intronic
1046720042 8:117608876-117608898 CAGGGTGCATATTTTCAAGTAGG + Intergenic
1047594402 8:126363296-126363318 CAGGGAGTCCATTTAAAAGATGG + Intergenic
1047597775 8:126395924-126395946 CAGAATGTACATTTGGAAGTGGG - Intergenic
1050474796 9:6029611-6029633 CAGCTTGTTCACTTTGAAGTAGG - Intergenic
1050973244 9:11904939-11904961 CACAGTATCTATTTTGAAGTGGG + Intergenic
1059811121 9:117856689-117856711 CAGGGTGGTCATTTTAAAGCAGG + Intergenic
1061173236 9:128974830-128974852 CAGGGGGTGCAGGTTGAAGTGGG - Intronic
1062263260 9:135674027-135674049 GTGGGTTTCCATTTTTAAGTTGG - Intergenic
1062681202 9:137782306-137782328 CTGGTGCTCCATTTTGAAGTTGG - Exonic
1186942171 X:14521565-14521587 CAGGGTGTCCAGCTTGCAGATGG + Intergenic
1189231053 X:39452794-39452816 CAGGGGGTTCATGTGGAAGTTGG - Intergenic
1191011156 X:55760926-55760948 CACTGTCTCCATTTTGAAGATGG + Intergenic
1193197966 X:78656693-78656715 CATGGTTTCCAATTTGAACTTGG + Exonic
1193206620 X:78755846-78755868 CAGGGACTCCATTCTGATGTGGG - Exonic
1195130258 X:101844129-101844151 CAAGGTGTACATTTTGAAATTGG - Intronic
1195176012 X:102316137-102316159 CAAGGTGTACATTTTGAAATTGG + Intronic
1195182852 X:102370956-102370978 CAAGGTGTACATTTTGAAATTGG - Intronic