ID: 909305504

View in Genome Browser
Species Human (GRCh38)
Location 1:74070749-74070771
Sequence CTGTTGAAGGGGCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 0, 2: 11, 3: 66, 4: 645}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909305498_909305504 -6 Left 909305498 1:74070732-74070754 CCTCTCAATTTCAAAATCTGTTG 0: 1
1: 0
2: 4
3: 28
4: 280
Right 909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG 0: 1
1: 0
2: 11
3: 66
4: 645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909305504 Original CRISPR CTGTTGAAGGGGCAGGAGGA AGG Intronic
900415592 1:2533045-2533067 CTGCGGAGGGGGCTGGAGGAGGG + Intergenic
900808990 1:4786941-4786963 TTGTGGAAGGGGCAGGGGTAGGG - Exonic
902168529 1:14592254-14592276 CTCTTGGAGGGGGATGAGGAGGG + Intergenic
902211463 1:14907756-14907778 CTGTTGAAGGAGCATGATGGGGG + Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902939936 1:19793719-19793741 CTGGAGGAGGGGCAGGAGGGTGG + Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903491079 1:23729081-23729103 ATCTTGAAGGAGGAGGAGGAAGG - Intergenic
904699498 1:32350047-32350069 TTCTTGAGGGGGCAGGGGGACGG - Intergenic
904719729 1:32499086-32499108 CTGAGGAATGGGCAGGAGAAAGG - Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905002899 1:34687186-34687208 GAATGGAAGGGGCAGGAGGAAGG - Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905528369 1:38656495-38656517 CTGGTCAGGGAGCAGGAGGAGGG + Intergenic
906306598 1:44723925-44723947 GGGCTGAAGGGGGAGGAGGAAGG - Intronic
906722631 1:48020134-48020156 CTCTGGAAGGGGCAAGAGGTGGG + Intergenic
906732699 1:48096915-48096937 TTGTTGAAAGGAAAGGAGGAAGG - Intergenic
907297986 1:53467782-53467804 CTATGGAAGGAGCTGGAGGAAGG - Intergenic
907413479 1:54298343-54298365 CTGACGAGGGGGCAGCAGGAAGG + Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907760475 1:57353746-57353768 GTGTGGAAGGGGGAGGAGCAGGG - Intronic
908389943 1:63675267-63675289 CTGCTGAAGGAGCTGGGGGAGGG + Intergenic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909562980 1:77025781-77025803 CTGGAGGAGGGGCAGCAGGAGGG - Intronic
910764304 1:90765572-90765594 CTGTTGGAAGGGCAGGGTGAGGG - Intergenic
911215393 1:95187688-95187710 GTATGGAAGGGGCAGGGGGAGGG - Intronic
911440146 1:97916326-97916348 CTGTTGTGGGGTCGGGAGGAGGG - Intronic
911718597 1:101165221-101165243 CTGCTGAAGGGTAAGTAGGAAGG + Intergenic
912092657 1:106100417-106100439 GTGTTGGAGGGGCAGGGGCAGGG - Intergenic
912410595 1:109478305-109478327 GTGTAGAACAGGCAGGAGGAGGG - Intronic
912867049 1:113266987-113267009 GTGTTGGAGGAGCAGCAGGAAGG - Intergenic
913069485 1:115286033-115286055 GTGTAGAAGGGGCAGGGGGAGGG + Exonic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913466357 1:119147233-119147255 CTGGGGAAGGGGCTGGCGGAGGG - Intergenic
913578152 1:120197507-120197529 CTGTGGTGGAGGCAGGAGGAGGG + Intergenic
915289076 1:154870630-154870652 CTGATGAGGGGGCAGACGGAGGG + Intergenic
915515532 1:156410345-156410367 CTGATGTCGGGGCAGGGGGATGG - Intronic
916624480 1:166540234-166540256 CTGTAGAAGGTGCAAGAGAAAGG + Intergenic
916741272 1:167649186-167649208 TAGTTGAAGGGTGAGGAGGAGGG + Intronic
917263781 1:173197674-173197696 CTGTTGCAGGGGCAAGGGGAGGG + Intronic
920199469 1:204250638-204250660 CTGCAGCAGGGGCAGGATGAGGG + Intronic
920202865 1:204270820-204270842 CTGGTGAAGGGGCAGAAGGTGGG - Intronic
920227964 1:204451509-204451531 TTGTTGAATGGGCTGCAGGAAGG - Intronic
920347758 1:205317586-205317608 CGGTAGAGGGGGCTGGAGGATGG - Intronic
920856378 1:209665912-209665934 CTCTTCTAGGGGCAGGAAGAAGG + Intergenic
921095589 1:211884801-211884823 CAGCTGATGGGGAAGGAGGATGG - Intergenic
921108444 1:212008584-212008606 CTGACGTCGGGGCAGGAGGACGG - Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921879776 1:220243017-220243039 ATGTTGAAGGTGCATGTGGAAGG - Intronic
922346274 1:224699363-224699385 CTGCCGAAGGGCCAGGAGAAGGG - Intronic
922390097 1:225132355-225132377 CTGTTGTGGGGGCAGAGGGAGGG - Intronic
922586257 1:226736914-226736936 CTGCGGAAGGGGCACGGGGAGGG + Exonic
922613270 1:226945347-226945369 CTGTTCACGGGGCTGGATGAGGG + Intronic
922614166 1:226951348-226951370 CTCCTGAAGCGACAGGAGGAGGG + Intronic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
922976615 1:229789845-229789867 CTGTTTGCAGGGCAGGAGGAGGG + Intergenic
923468997 1:234273483-234273505 TTTTTGAAGAGGCAGCAGGAAGG + Intronic
923997884 1:239517115-239517137 CTATGGACCGGGCAGGAGGATGG - Intronic
924140012 1:241012524-241012546 CTGATGAAGGGTCAGGAAGGGGG - Intronic
924609237 1:245560094-245560116 CTGGAGAAGGGACAAGAGGAAGG - Intronic
924630180 1:245730304-245730326 CTGTTGAGGGGTTAGGGGGAGGG + Intergenic
1063748025 10:8908209-8908231 CTGTTGGGGGCGCAGGGGGAGGG + Intergenic
1063969230 10:11369869-11369891 CTGTTGTAGGGGCAAAAAGAAGG - Intergenic
1064116986 10:12586663-12586685 CTGGTGAGGGGGCAGCAGGAGGG - Intronic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1065882360 10:30047664-30047686 CTGCAGAACGGGCATGAGGATGG - Exonic
1066271383 10:33827540-33827562 CTGTTGGTGGGGCAGGGGGATGG + Intergenic
1067101681 10:43338903-43338925 CTGTTGCATGGGCGGGAGGTGGG + Intergenic
1067317557 10:45182259-45182281 CTGTTGTGGGGGCAGGAGGAGGG + Intergenic
1067338731 10:45384112-45384134 CTGATGCAGGGGGAGGGGGAAGG + Intronic
1067437280 10:46287129-46287151 CTGGTGAAAGGGCAGGAGGAGGG + Exonic
1067748745 10:48956320-48956342 AGGTTCAAGGGGCAGGAGGCTGG - Intronic
1068438367 10:57019568-57019590 TTGTGGAAGGGGCAGTGGGAGGG - Intergenic
1069028722 10:63572468-63572490 CTGTTGGAGGGTCAGGGGCAAGG - Intronic
1069769888 10:70891484-70891506 CAGTTGAAGGGTGATGAGGATGG + Intergenic
1069944618 10:71977299-71977321 ATGTTGAAGGGGCAGCTGGGAGG - Intronic
1070508566 10:77138989-77139011 CTGAGGAACGGGCAGGAGGCAGG - Intronic
1070617223 10:77978382-77978404 GTGCTGAAGGACCAGGAGGAGGG + Intronic
1070654562 10:78262478-78262500 ATATTGAAGGGTCTGGAGGAAGG + Intergenic
1070731761 10:78833682-78833704 CGGGTCAAGGGGCAGGAGGGAGG - Intergenic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071794443 10:88990392-88990414 CTTTAGAAAGGGCAGGAGGCCGG + Intronic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1071957898 10:90779080-90779102 CTGATGAAAGGCCAGGAGGAAGG + Intronic
1071996904 10:91158420-91158442 GATTTGAAGGGGGAGGAGGAAGG + Intergenic
1072254981 10:93612921-93612943 CTGTGGACCGTGCAGGAGGAGGG + Exonic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072323471 10:94273394-94273416 CTGTGAAGGGGGCAGGAGCAGGG + Intronic
1072724372 10:97802737-97802759 CTGGTGAAGGGATGGGAGGAGGG + Intergenic
1073066904 10:100766495-100766517 CTGTTGGAGCTGGAGGAGGATGG - Intronic
1073483370 10:103800990-103801012 GTGGTGAAGAGGCGGGAGGATGG - Intronic
1073502142 10:103949870-103949892 CAGTGGAAGGGGCAGGGGAAAGG + Intergenic
1074134978 10:110618223-110618245 CTGTGGCAGGGGCCTGAGGAGGG + Intergenic
1074261497 10:111858042-111858064 CTGTTCTGGGGGCAGGAGGAGGG - Intergenic
1074527924 10:114277851-114277873 AAGATGAGGGGGCAGGAGGAGGG + Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074784820 10:116829542-116829564 CCGGTGAGGGGGCAGGAAGAGGG + Intergenic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075198344 10:120380184-120380206 CGGTTTGAGGGGCAAGAGGAGGG + Intergenic
1075786958 10:125056661-125056683 CCGTTCTAGAGGCAGGAGGATGG - Intronic
1075944445 10:126420034-126420056 GTGTTGAGGGGGTGGGAGGAGGG + Intergenic
1076682590 10:132181502-132181524 CTCTAGAAGGTACAGGAGGAAGG - Intronic
1076815632 10:132913441-132913463 CTGTTGATGGGACGGGAGGCGGG - Intronic
1077032240 11:473771-473793 CTGATGCTGGGGCGGGAGGAAGG - Intronic
1077164795 11:1130175-1130197 CAGATGAAGGGGCCGGGGGAGGG + Intergenic
1077195734 11:1279072-1279094 ATGGGGAAGGGACAGGAGGAGGG + Intronic
1077232023 11:1462009-1462031 AAGGTGAAGGGGTAGGAGGAGGG + Intronic
1078264999 11:9748645-9748667 GTGCTGAAGGGACACGAGGAGGG - Intronic
1078514982 11:12014315-12014337 CTGTTGCAGGGGCAGACAGAGGG + Intergenic
1078649669 11:13177037-13177059 CTGTTGAAGAAGCAGGAGCATGG + Intergenic
1078862215 11:15259592-15259614 CTGTTGAAGAAACAGGATGAGGG + Intergenic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1079340181 11:19605256-19605278 GGGTTGAAGGGGCAGCTGGATGG - Intronic
1079755730 11:24258738-24258760 CTGTTGAACTGACTGGAGGAGGG - Intergenic
1081109603 11:39118539-39118561 TGGTTGAATGGGCAGCAGGATGG + Intergenic
1081374201 11:42339778-42339800 ATGTTGAAGAGGCAGCTGGATGG + Intergenic
1082793189 11:57361440-57361462 CTGTTGGGGGTGCAGGGGGAAGG - Intronic
1083261482 11:61525423-61525445 GTGTTGAAGGGCCAGGAAGGAGG - Intronic
1083966196 11:66045386-66045408 CTGCTGCAGGCGCTGGAGGATGG + Exonic
1083976419 11:66125189-66125211 CGGGTGAAAGGGCAGGAGGCAGG + Intronic
1084490916 11:69477801-69477823 CTTTTTAAGGGGCAGGATGTGGG + Intergenic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085473172 11:76771207-76771229 GGGTGGAAGGGGCAGGAGGAGGG - Intergenic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1086002859 11:82001881-82001903 CTGTTGGAGGGGCAAGAGTGAGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087822400 11:102727250-102727272 CTGCCGAAGGGGCAGGAGGGAGG - Intergenic
1088494687 11:110421219-110421241 CTGTTGCAGGGGCTTGTGGAGGG - Intergenic
1088972004 11:114781761-114781783 CTGGTGGAGGTGAAGGAGGAAGG - Intergenic
1089015512 11:115162166-115162188 CAGTAGAAGTGGCGGGAGGAGGG + Intergenic
1089122376 11:116146366-116146388 CTGTTGGAGGGGCAAGAGTGAGG - Intergenic
1089249007 11:117144300-117144322 CTGGTGCTGGGGCCGGAGGAGGG + Exonic
1089667980 11:120032411-120032433 CTGCTGAAGGGGTAGGTGGCAGG - Intergenic
1090236266 11:125150033-125150055 ATGTTGAAGAGATAGGAGGAGGG - Intergenic
1090376100 11:126290835-126290857 TTGGTGAAGGGGGAGGAGGGAGG - Exonic
1090446515 11:126769178-126769200 GTGTTGAAAGCGTAGGAGGAAGG - Intronic
1090678432 11:129027506-129027528 TTGGTAAAGGGTCAGGAGGAAGG - Intronic
1090931370 11:131300684-131300706 ATGTTGGAAGGGGAGGAGGAGGG - Intergenic
1091196155 11:133732607-133732629 CTGGACAAGGGGCAGGGGGATGG - Intergenic
1091319986 11:134642524-134642546 CTGTGGAAGGTGCAGGAAGAGGG - Intergenic
1091900713 12:4141890-4141912 TTTTTGAAGGGGCAGTAGTATGG + Intergenic
1092527741 12:9319496-9319518 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1092659801 12:10725701-10725723 CTGTTGGAAGGGCTGAAGGAGGG + Intergenic
1092930370 12:13309853-13309875 CTATTGGAGGGGAAGGAGGAAGG - Intergenic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094499988 12:31012543-31012565 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1095184357 12:39184689-39184711 GTGTTGAGGGGGATGGAGGATGG - Intergenic
1096192750 12:49631052-49631074 CAGATGAAGGGGCAGAAGGCAGG - Intronic
1096543467 12:52321604-52321626 CAGTGGGAGGGGCAGGAGCAAGG - Intergenic
1096627060 12:52902480-52902502 CTGAGGCAGGGGCAGGAGAATGG - Intronic
1096846536 12:54410228-54410250 GTGGAGCAGGGGCAGGAGGATGG + Intronic
1096929358 12:55188553-55188575 CTGTTGGGAGGGCATGAGGAGGG + Intergenic
1097057089 12:56256857-56256879 CAGTTCTAGGGGTAGGAGGAAGG + Intronic
1097229395 12:57500245-57500267 TGGTTGGAGTGGCAGGAGGAAGG + Intronic
1098507471 12:71270768-71270790 CTGTTGAAGAGCAGGGAGGAGGG - Intronic
1098599838 12:72317881-72317903 GGGCTGAAGGGGCAGGAGGAAGG + Intronic
1099196604 12:79624276-79624298 TAGTTGAGGGGGCAGGAGGAGGG - Intronic
1099488258 12:83254694-83254716 CATTTGAAGGCTCAGGAGGAAGG + Intergenic
1099545649 12:83976666-83976688 CTGTTGCAGGGTTAGGAGCAAGG + Intergenic
1099618898 12:84975899-84975921 TAATTGAAGGGTCAGGAGGATGG - Intergenic
1101036320 12:100710678-100710700 CTGTTGGTGGGGGAGGGGGAGGG + Intergenic
1101683730 12:106995803-106995825 CTGTTGGGGGGGCAGGGGCAGGG - Intronic
1101969699 12:109304528-109304550 CTGATGAAGGGGCAGGGGACTGG - Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1102424009 12:112826258-112826280 ATGTTGAGGGAGCAGCAGGAAGG + Intronic
1102426497 12:112848111-112848133 TTGAAGAAGGGGCAGGGGGAGGG + Intronic
1102928936 12:116847995-116848017 CTGTTGCGGGGGCTGGGGGAGGG - Intronic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1103909786 12:124345861-124345883 CTTGTGAAGGGGAAGGAGAATGG - Intronic
1104270379 12:127278030-127278052 TTGATGACGTGGCAGGAGGAGGG + Intergenic
1104295492 12:127508144-127508166 CTGTAAAATGGGTAGGAGGATGG + Intergenic
1104549919 12:129746996-129747018 CGGATGAATGGGCAGGAGCAAGG - Intronic
1104768728 12:131346718-131346740 CTGTTGCAGGAGCAGGACGGAGG + Intergenic
1106006439 13:25774403-25774425 CTGTTGGGGAGGCAGGGGGAGGG + Intronic
1106019742 13:25903310-25903332 GTGGTGGAGGGGCAGCAGGAAGG - Intronic
1106411222 13:29513011-29513033 ATGCTGATGGGGGAGGAGGAGGG - Exonic
1106615461 13:31323097-31323119 CTGTTGCAGGGGACGGAGGAGGG + Intronic
1107062930 13:36180275-36180297 GTGGTGAAGGGGGAGGAGGCTGG - Intronic
1107620804 13:42227100-42227122 CTGTTGTGGGGGCAGAAGGAGGG + Intronic
1108085960 13:46794140-46794162 TTTTTGGAGGGGAAGGAGGAAGG - Intronic
1108775503 13:53761064-53761086 ATGTTGAAGGGGGAGGAAGGTGG + Intergenic
1110383279 13:74878711-74878733 GTATTAAAGGGGCAGCAGGAAGG - Intergenic
1111152255 13:84269741-84269763 GTGTTGAAGGGACAGGAAGGAGG - Intergenic
1111716615 13:91886929-91886951 CTGTTCTAGGGTCTGGAGGATGG + Intronic
1111915463 13:94355928-94355950 CTGTTGTGGGGGCAGGGGGAGGG - Intronic
1112004342 13:95241517-95241539 CTGCAGGGGGGGCAGGAGGAAGG - Intronic
1112043655 13:95573867-95573889 CTGTTGTGGGGGGAGGAGGGAGG - Intronic
1112760991 13:102692946-102692968 CTGGTTTAGAGGCAGGAGGAAGG + Intronic
1113055534 13:106263118-106263140 CTCTTGAAGTGGAAGGTGGAAGG - Intergenic
1113783008 13:112987232-112987254 CGCTGGAAGGGGCAGGTGGAGGG - Intronic
1113834032 13:113317105-113317127 CTGTTGCCGGGAGAGGAGGAGGG + Intronic
1116153619 14:41174496-41174518 CTGTTTAAGGTGCAAGAAGAGGG - Intergenic
1116247247 14:42431717-42431739 CTGTTGGAGGGGCAGCGGTAGGG - Intergenic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119933151 14:78567138-78567160 GTCTTGAAGGGGCTGCAGGATGG + Intronic
1120684698 14:87524660-87524682 CTGTCGAGGGGGCAGGAGGAGGG + Intergenic
1120691159 14:87594665-87594687 CTGTAGAAGGGTTGGGAGGAAGG - Intergenic
1120722681 14:87905489-87905511 GTGGTGCTGGGGCAGGAGGATGG + Intronic
1121325432 14:93016920-93016942 CTGGAGATGGGGCAGGAGGAGGG + Intronic
1122442632 14:101742772-101742794 CTATTGAAGGTGCCTGAGGAGGG + Intergenic
1122603004 14:102930491-102930513 CTGGTGAGGGGGCTGGAGGGGGG + Exonic
1122863076 14:104591297-104591319 CTGAAGGAGGGGCAGGAGGCAGG - Intronic
1122873080 14:104650449-104650471 CTGACGACGGGGGAGGAGGAGGG - Intergenic
1123192055 14:106580873-106580895 CTGATTAAGGGGCCTGAGGATGG - Intergenic
1123964596 15:25442323-25442345 CTGTAGAAAGGACAGAAGGATGG - Intergenic
1124108566 15:26764784-26764806 CTGCTGAGTGGGCAGGCGGAAGG + Intronic
1124220543 15:27846786-27846808 ATGTTGAAGGATCTGGAGGAGGG + Intronic
1124471436 15:29990151-29990173 CATTTGATGGGGTAGGAGGACGG - Intergenic
1124614882 15:31234312-31234334 CTGAGGAAGGGGCAGAAGGGTGG + Intergenic
1125460806 15:39905013-39905035 TGGTTGTAGGGGCTGGAGGAGGG - Intronic
1125723012 15:41854102-41854124 CTGATGAAGGGGGAGGACGGAGG - Exonic
1126301699 15:47203744-47203766 CTTTTGCAGGGGCAGAAAGAAGG - Intronic
1127269870 15:57390796-57390818 CTGTGGGAGGAGCAGAAGGATGG + Intronic
1127471694 15:59295955-59295977 CTAAAGAGGGGGCAGGAGGAGGG + Intronic
1127595577 15:60478914-60478936 CTCATGCAGGGGCGGGAGGAGGG - Intronic
1127725505 15:61745388-61745410 CTGTGGACGGGGCAAGGGGATGG - Intergenic
1128085109 15:64880801-64880823 GTCTTGAGGGGACAGGAGGAGGG - Intronic
1128233324 15:66050488-66050510 ATGTGCAAGGGGCAGGAGGGAGG + Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129179557 15:73865354-73865376 CTTGTGAAGGGGCAGGAGAAGGG + Intergenic
1129333980 15:74841701-74841723 CTTGTGAAGGGGCAGAGGGAAGG - Intronic
1129525054 15:76208531-76208553 CTGTGGGATGGGCTGGAGGAAGG - Intronic
1129880846 15:79005190-79005212 CTGAGGTGGGGGCAGGAGGAGGG + Intronic
1129897150 15:79117004-79117026 CTGCTGAAGAGGCAGGTGGAAGG + Intergenic
1130146179 15:81275343-81275365 CAGTTGACGGGGGAGGAGGGGGG + Intronic
1130327867 15:82896071-82896093 CTGTAGAGGGGGCTGGAGGTGGG + Intronic
1130904035 15:88227529-88227551 CAGGTGAAGGGGCAGCAAGAAGG + Intronic
1131090903 15:89624429-89624451 CTTTAGAAGGGGGTGGAGGAGGG - Exonic
1131591740 15:93756627-93756649 CTGTTGTGGGGGTAGAAGGACGG + Intergenic
1131822404 15:96286154-96286176 GTGTTGAAAGGGCAGGAACAAGG + Intergenic
1131988244 15:98066453-98066475 CTGCTGAAGGAGCACGAGGGGGG - Intergenic
1132180686 15:99750620-99750642 ATGTTGGAGGGGAAGGAGGGAGG - Intergenic
1132180697 15:99750667-99750689 ATGTTGGAGGGGAAGGAGGGAGG - Intergenic
1132180708 15:99750714-99750736 ATGTTGGAGGGGAAGGAGGGAGG - Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1132849024 16:2015912-2015934 CTTTTCAGGCGGCAGGAGGAAGG - Intronic
1134357836 16:13500900-13500922 CTCTGGAAGTTGCAGGAGGATGG + Intergenic
1134619234 16:15675120-15675142 GTGCTCAAGGGGCAGGAGGTGGG + Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1137306719 16:47207782-47207804 CTGTGGAAGGGGCGGGAGGGTGG - Intronic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1137715655 16:50596839-50596861 CTGAAGGAGGGGCAGGAGGGAGG + Intronic
1138350222 16:56342390-56342412 CTGTGGAGGGGGCAGCAGGGAGG - Intronic
1138568600 16:57852360-57852382 CTGATGATGAGGCAGGAGGTGGG - Intronic
1138734976 16:59240038-59240060 GGCTTGAAGGGGCAAGAGGACGG + Intergenic
1139924459 16:70478528-70478550 CTGCGGACGGGGCAGGAGAAGGG - Intronic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140403882 16:74694723-74694745 CTGTTGCACGGGCTAGAGGACGG - Intronic
1140404703 16:74700921-74700943 GTGTGGAAAGGACAGGAGGAAGG - Intronic
1141031060 16:80588988-80589010 CTGTGATAGGGGCAAGAGGAAGG + Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1142128594 16:88422161-88422183 CAGGTGGATGGGCAGGAGGATGG + Intergenic
1142223560 16:88866605-88866627 ATGGTAGAGGGGCAGGAGGAAGG + Exonic
1142289630 16:89187640-89187662 TTCATGATGGGGCAGGAGGATGG + Intronic
1142399351 16:89851261-89851283 CTGGTGGGGAGGCAGGAGGAAGG - Intronic
1142694369 17:1625258-1625280 CTGGTGAGGTGGCAGAAGGAAGG - Intronic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1143780043 17:9224588-9224610 CTGTGGAAGGGGCGGGAGGCTGG - Intronic
1144125050 17:12195711-12195733 CTGGTGGCAGGGCAGGAGGAAGG - Intergenic
1144393040 17:14813849-14813871 CTTTTCAAGGGGCAGGTCGAGGG - Intergenic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1144691048 17:17264039-17264061 CTGTTGAGGGGACCTGAGGAGGG - Intronic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1146296095 17:31651877-31651899 CTGTGGAGCGGGCAGGAGGATGG + Intergenic
1146450021 17:32965414-32965436 AAGATCAAGGGGCAGGAGGAAGG + Intergenic
1146646156 17:34578901-34578923 CTGTTGCTGGGGAAGGAAGACGG - Exonic
1146831940 17:36076963-36076985 CTGGTGAAGGGCGAGGAGAAAGG + Intergenic
1147167538 17:38601468-38601490 CGGTTGGAGGGGCGGGAGGCTGG + Intronic
1147179593 17:38675699-38675721 CGGTTGAAGAGGCCAGAGGAGGG + Intergenic
1147416619 17:40295904-40295926 CAGCAGGAGGGGCAGGAGGATGG - Intronic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147961153 17:44168419-44168441 CTGCTGCAGGGCCAGGAGGCAGG + Intergenic
1148087936 17:45006041-45006063 AGGTTGAGGGGCCAGGAGGAAGG - Intergenic
1148212017 17:45814329-45814351 CAGTTAAGGGGGCAGCAGGAAGG - Intronic
1148437374 17:47694539-47694561 CTCTTAAAGGGGCCGCAGGAGGG + Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1148846388 17:50532513-50532535 CTGTTGAAGAGGCAGGGGAAGGG + Intergenic
1149098673 17:52876184-52876206 TTGTTGCAGGGGCAGGAGGTGGG + Intronic
1149461356 17:56832687-56832709 GTGTTTAAGAGGGAGGAGGAGGG - Intronic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150249046 17:63696118-63696140 GGGTGGAAGGGGCAGGAGGGTGG - Exonic
1150416919 17:64995439-64995461 CTGAGGAAGGGACAGAAGGATGG + Intergenic
1150739150 17:67765656-67765678 CAGATGATGGGGCAGGAAGACGG - Intergenic
1150943345 17:69717482-69717504 CTGCTGAAGGGGCTGGAAGCAGG - Intergenic
1150983544 17:70169679-70169701 CTGTTGCTGGCGCAGGAGCATGG - Exonic
1151990721 17:77572371-77572393 CAGATGGAGGGGCAGGAGGAGGG - Intergenic
1152368377 17:79870387-79870409 CTCCTGAAGAGGCAGGTGGAGGG + Intergenic
1155086884 18:22467597-22467619 CAGTTGCAGGAGCAGCAGGAGGG + Intergenic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1157648481 18:49302595-49302617 CTGTTGAAGGCGGAGGTGGGGGG + Intronic
1158450282 18:57557881-57557903 AGGATGAAGTGGCAGGAGGATGG + Intronic
1158455451 18:57603024-57603046 CTGTTGAATTGATAGGAGGAAGG - Intronic
1158618881 18:59013127-59013149 CGGGAGAAGGGGCAGGAGGGTGG - Intergenic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1160384719 18:78488214-78488236 GATTTGCAGGGGCAGGAGGAAGG - Intergenic
1160498289 18:79388019-79388041 CTGGTGGAGTGGCAGGGGGAGGG - Intergenic
1160809426 19:1007061-1007083 ATGTTGATGGGGAAGGAGGCTGG + Intronic
1161303744 19:3555978-3556000 CTGTTGGGAGGGCAGGAGGCTGG - Intronic
1161716726 19:5880512-5880534 GTGGGGAAGGGGCAGGGGGAGGG - Intronic
1162180766 19:8867305-8867327 CAGATGAATAGGCAGGAGGATGG + Intronic
1162180851 19:8867756-8867778 CAGGTGAATGGGCAGGAAGATGG + Intronic
1162180891 19:8867927-8867949 CAGGTGAATGGGCAGGAGGATGG + Intronic
1162565987 19:11446109-11446131 CTGAGGAGGGGGCAGGAGGGTGG + Intronic
1162567924 19:11454291-11454313 CTGGGGTGGGGGCAGGAGGATGG + Exonic
1162767774 19:12930391-12930413 CTGGTCAGGGGGCAGGTGGACGG - Intronic
1163090402 19:15015543-15015565 ATGTTGATGGTGCAGGAGAAGGG - Intronic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1163636751 19:18440589-18440611 CTGTAGAGGGTGCCGGAGGATGG + Intergenic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1163784941 19:19270159-19270181 CTGCAGAAGGTGCAGGAGGCAGG - Exonic
1163827332 19:19530969-19530991 ATGTTCAAGGGGCAGAAGGGAGG - Intronic
1164450784 19:28362516-28362538 CTGTTGAAGGGAGAAAAGGAAGG - Intergenic
1164590712 19:29505331-29505353 CTGGGGGAGGGACAGGAGGAGGG + Intergenic
1164631292 19:29763116-29763138 CTCTTGAGGGGGCAGCAGGCTGG - Intergenic
1164744938 19:30604894-30604916 CTGGAGAAGGGACAGCAGGAAGG + Intronic
1165106007 19:33470034-33470056 CTGCTGAAGCAGCAGGAAGATGG - Intronic
1165135070 19:33662656-33662678 AAGGTGGAGGGGCAGGAGGAAGG + Intronic
1165428375 19:35757791-35757813 CTGTTGCAGGGGCAGTGGGGCGG - Intronic
1165831926 19:38734781-38734803 CTGGGATAGGGGCAGGAGGAGGG - Intronic
1166124254 19:40704252-40704274 CTATTCAGGAGGCAGGAGGATGG - Intronic
1166217326 19:41344226-41344248 CTTTTGAAGGCCAAGGAGGATGG - Intronic
1166279370 19:41780774-41780796 CTGGTGATGGGGGAGGTGGAAGG + Intergenic
1166345075 19:42160475-42160497 CTGATGATGTGACAGGAGGAGGG - Intronic
1167201813 19:48070737-48070759 CTGTTGAGGGGGCGGTGGGAGGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168136617 19:54356210-54356232 CAGGTAAAGGGGGAGGAGGAGGG - Exonic
1168262659 19:55205270-55205292 TTGTTTAAGGGGCAGTAGGCAGG - Intronic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
925047090 2:780716-780738 CTTGTGCAGGGGCTGGAGGAAGG + Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925306138 2:2849264-2849286 CTGTGGAGGGGGCAGGCAGATGG - Intergenic
925686664 2:6480461-6480483 CTTGTGAAGGGGCAGGGGAAAGG + Intergenic
925748454 2:7065303-7065325 CAGTTGATGGGGCCAGAGGAAGG - Intronic
926183287 2:10665572-10665594 ATGTTGAAGGGATAGGAGGTAGG - Intronic
926212581 2:10882058-10882080 CTGTTGTGGGGGCAGGAGGAGGG - Intergenic
926765708 2:16321293-16321315 CTGTTGCAGTGGCAGGAACATGG + Intergenic
927064858 2:19461067-19461089 CAGTTGCAGGGGGAGGGGGATGG - Intergenic
927246288 2:20959448-20959470 CAGTGGGTGGGGCAGGAGGATGG + Intergenic
927937279 2:27082967-27082989 CTGTTGGAGGAGCAGGTGGCAGG + Exonic
927993548 2:27465582-27465604 CTGGTGATGGGGCAAGGGGAGGG + Intronic
928172916 2:29014813-29014835 TTGCTGAAGGGGTAGGAGGGAGG + Intronic
928498925 2:31866206-31866228 CTGGTGAAGGGGCAGAATGATGG + Exonic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929413570 2:41724452-41724474 CTGTTGACTGTTCAGGAGGAAGG + Intergenic
929425221 2:41838253-41838275 CAAGTGGAGGGGCAGGAGGAAGG - Intergenic
929906105 2:46048110-46048132 CTATGGAAGGGGCAGGGGGTGGG - Intronic
930067069 2:47335797-47335819 CTGTTGGTGGGGTGGGAGGAGGG - Intergenic
930320480 2:49848408-49848430 CTGTTGGAGGGGTAGGGGGAGGG - Intergenic
930865723 2:56120430-56120452 CTTTTGGAAGGGAAGGAGGAGGG - Intergenic
931054238 2:58450859-58450881 ATTTTGAAAGAGCAGGAGGAAGG - Intergenic
931122922 2:59240545-59240567 CTTTTCTAGAGGCAGGAGGATGG - Intergenic
932788471 2:74630479-74630501 CCGTTGAGGAGGCGGGAGGAGGG - Intronic
933158585 2:79000253-79000275 CAGTTGAAGGGCCAGGAGTGTGG + Intergenic
933190393 2:79327795-79327817 ATGCAGAAGGGGCAGGGGGATGG + Intronic
935070880 2:99692488-99692510 CTGATGAAGGGCCTGGAAGAAGG + Intronic
935523809 2:104141984-104142006 CTGTAGAAGGGTCAGAAGGTGGG - Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
935914289 2:107932529-107932551 CTGTTGAATGGGCAGGCTCATGG + Intergenic
936154585 2:110039831-110039853 CTGGGGATGGGGCAGGGGGAGGG + Intergenic
936190098 2:110331583-110331605 CTGGGGATGGGGCAGGGGGAGGG - Intergenic
937017637 2:118620260-118620282 GTGTTCAAGGGGCAGGAGCATGG - Intergenic
937124069 2:119462082-119462104 GTGTTGTAGGGGCAGGAGCCAGG + Intronic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937751076 2:125476842-125476864 CTGTTCTAGGGTCTGGAGGATGG - Intergenic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938134231 2:128740648-128740670 GTGTTGAAGGGTGAGGATGAAGG - Intergenic
938173269 2:129101837-129101859 CTGTTGAGTGGCCAGGAGCAAGG + Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938598296 2:132811611-132811633 CTGTTGAGGGGGCAGGGGGCAGG - Intronic
938724755 2:134097435-134097457 ATATTGGAGGGACAGGAGGATGG - Intergenic
938889812 2:135692798-135692820 CTGTGGTAGTGGCAGTAGGAGGG + Intronic
939086626 2:137726942-137726964 ATGTTGAAGGTGGAGGAGCATGG - Intergenic
940248506 2:151647043-151647065 CTGTTGAAGAGACATAAGGATGG - Intronic
940569808 2:155416971-155416993 CAGTTGAAGGGTGAGGAGGGTGG + Intergenic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941640658 2:167984278-167984300 CTGTTGGAGGGGCAGGAACAAGG + Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942568927 2:177293881-177293903 GTGTTGTAGGGGGAGAAGGAGGG - Intronic
942647879 2:178134220-178134242 CTGCAGAAGTGGCAGAAGGAAGG + Intronic
942845048 2:180414015-180414037 TGGGTGAAAGGGCAGGAGGAGGG - Intergenic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
943593197 2:189823420-189823442 CTGTTGAGGGGGTGGGAGGAAGG - Intronic
946371569 2:219284730-219284752 CTGTCCAAGGGGCATGAGGCAGG - Exonic
946602889 2:221371467-221371489 CTGGCGACGGAGCAGGAGGAAGG - Intergenic
946621721 2:221570244-221570266 ATGTTGAAGGGGAGGGAGGGAGG - Intronic
946687946 2:222290763-222290785 CTGCTGGAGGGGGAGAAGGAGGG + Intronic
946708599 2:222484266-222484288 GTGGGGAAGGGGCAGCAGGAAGG - Intronic
946728714 2:222688052-222688074 TTTTTGAAGGGGGAGGTGGAAGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947938320 2:234026203-234026225 GTTTTGAAGGGGCTGGAGGGTGG - Intergenic
948017894 2:234704963-234704985 CTGCAGAGGGGGCAGGGGGAAGG + Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948777006 2:240294419-240294441 CAGTTGGGGAGGCAGGAGGAGGG - Intergenic
948796674 2:240406494-240406516 TTTTGGAGGGGGCAGGAGGAAGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1169875664 20:10294549-10294571 ATGTGGAAGTTGCAGGAGGATGG - Intronic
1169891533 20:10458512-10458534 CTGTTGTGGGGGAAGGGGGAGGG - Intronic
1170075998 20:12419779-12419801 CTGTTGTGGGGGCAGGAAGAAGG - Intergenic
1171327266 20:24305569-24305591 GGGTTGAAGGAGGAGGAGGAAGG + Intergenic
1171401412 20:24875027-24875049 CTGCTTAAGGGGCAGGAGGTGGG - Intergenic
1171405237 20:24908336-24908358 CTGTTGGAGGGGTGGGAGGTGGG + Intergenic
1171413266 20:24960476-24960498 CTGTTGGGGGTGCACGAGGAGGG + Intergenic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172860536 20:38046741-38046763 CTGTTGTTGAGGCAGGAGGTTGG + Intronic
1173156505 20:40616916-40616938 CAGCTGAAGGAGCAGAAGGAAGG - Intergenic
1173590117 20:44218178-44218200 CTGTGGATGGGGCTGGAGGTGGG + Intergenic
1173758742 20:45541230-45541252 CTGTTGAGGGGGCAGGGGGAGGG + Exonic
1173976504 20:47190641-47190663 CAGTTTAATGGGCAGGTGGATGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174549858 20:51354636-51354658 CTCTTTAAGGAGCATGAGGAAGG - Intergenic
1174665528 20:52254347-52254369 CTGTGGCTGGGGCAGAAGGATGG - Intergenic
1174910376 20:54601672-54601694 ATGATGAAATGGCAGGAGGAGGG + Intronic
1175163898 20:57029554-57029576 AGGTTCAAGGGGCAGGAGGCTGG + Intergenic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1179043010 21:37821538-37821560 CTGTTGGGGGGGCAGGGGAAAGG - Intronic
1179167196 21:38944346-38944368 CTGTTGGAGGAGCAGGCGGGAGG - Intergenic
1179233460 21:39525709-39525731 CTGCTGAATAGGCATGAGGATGG + Intergenic
1179442698 21:41406456-41406478 CTGTTGAAGGAGCAGAAAGCTGG + Intronic
1179812037 21:43877953-43877975 CTGGTGGTGGGGCAGGAGGCGGG - Intronic
1180626792 22:17199114-17199136 CTGGTGGAGGGGGAGGGGGAGGG - Intronic
1180629752 22:17220232-17220254 CAGTAGAGGGGGCAGGAGGTAGG + Intronic
1182447061 22:30395998-30396020 GTGTTGAGGGGGCAGAAGTATGG + Intronic
1183063264 22:35348080-35348102 CTGTAGATGGTGCAGGCGGAAGG + Intergenic
1183383722 22:37503276-37503298 CTGGTGTGGGGGCAGGAGGAGGG - Intronic
1183397094 22:37577914-37577936 CTGCTGAAGGCGCAAGGGGAGGG - Intronic
1183469574 22:37998349-37998371 CCCTTCAAGGGGCAGGTGGAAGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183647127 22:39133385-39133407 GGGAGGAAGGGGCAGGAGGAAGG - Exonic
1183891609 22:40934411-40934433 ATCTTGGAGGGGCAGGGGGAGGG + Intergenic
1183987487 22:41577514-41577536 GTTCTGAAGGGGCAGGAGGAGGG - Intronic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1184176618 22:42792753-42792775 CGGTGGAAGGTGCAGCAGGACGG + Intergenic
1184270387 22:43377999-43378021 CTTTTCAAGGGCCAGGAGGAAGG - Intergenic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1185147913 22:49149426-49149448 CTTTTGCAGGGCCAGGAGGAAGG + Intergenic
1185231566 22:49686932-49686954 CTGCTCCATGGGCAGGAGGAGGG - Intergenic
949157357 3:845551-845573 CTGCTGCAGGGGCAGTGGGAGGG - Intergenic
949507872 3:4743732-4743754 TTGTTGAGGGGGAAGGGGGAGGG + Intronic
950020943 3:9787270-9787292 CTGCTGGAGGAGCAGAAGGATGG - Exonic
950691293 3:14660103-14660125 TTCCTGAAGGGGCAGCAGGATGG + Intronic
950866606 3:16194824-16194846 CTGTTGTGGGGGCATGGGGAGGG + Intronic
950882640 3:16335619-16335641 CTGTTGGAGGTGTGGGAGGAGGG + Intronic
953413721 3:42703742-42703764 CAGTTGAGGAGGCAGGAGGGAGG + Intronic
954133391 3:48571058-48571080 CAGTTGTAGGGGCAGCAGGCCGG - Intronic
954218223 3:49136159-49136181 CAGGTGAAGGGCCAGGAGGCTGG - Intergenic
954266219 3:49472169-49472191 CTGGTGGAGTGGCAGGAAGAGGG + Intronic
954442668 3:50530377-50530399 CTATTAGAGGGGCAGGAGGGGGG - Intergenic
954737950 3:52722241-52722263 ATGTTGAAGGGTGAGGAGGGTGG - Intronic
954876080 3:53803993-53804015 CCCTTGAAGTGGCAGGAGGCAGG - Intronic
955079027 3:55640617-55640639 CTGTGGTAAGGGCATGAGGAAGG + Intronic
955421270 3:58740373-58740395 CTGCTCAAGGAGCAAGAGGATGG - Intronic
956536242 3:70280222-70280244 CTTTTTAAGGGAGAGGAGGAGGG - Intergenic
959360836 3:105389733-105389755 CTGTTGAGGGGGTAGGGGGGAGG - Intronic
959660654 3:108864317-108864339 CCGTTGAAGGGGCAGGTCAAAGG - Intergenic
959991750 3:112638828-112638850 TTGTGGCTGGGGCAGGAGGAAGG + Exonic
960223603 3:115146328-115146350 ATGCTGAAGAGGCAGGAGGCAGG - Intronic
960641319 3:119826432-119826454 TTGTGGAAGGGGCATGAGGCAGG + Intronic
960779877 3:121308099-121308121 CTGTTGTTGGAGCAGGGGGAGGG + Intronic
960868968 3:122230526-122230548 CTGTTGCAGGGGGTGGGGGATGG - Intronic
961333989 3:126159277-126159299 CTGGTGACGGGGCAGGAGGAGGG - Intronic
961360519 3:126364505-126364527 TTCTTGAAGGAGCAGGAGGGAGG - Intergenic
961763543 3:129189874-129189896 CTTTGGAAGGTGGAGGAGGATGG - Intergenic
961816991 3:129556174-129556196 CTGGGGCGGGGGCAGGAGGAGGG - Exonic
961818471 3:129563321-129563343 CTGTTGGAGGGGTTGGGGGACGG - Intronic
962268714 3:133962475-133962497 GAGTTCAAGGGGCAGGAAGAAGG + Intronic
962389928 3:134962792-134962814 ATGAAGAGGGGGCAGGAGGAGGG - Intronic
964247445 3:154669905-154669927 ATGTTGAAGAGGCAGCAGGATGG + Intergenic
965449253 3:168817315-168817337 CTGATTAAGAGGCAGTAGGAAGG + Intergenic
966049208 3:175593157-175593179 CTTTTGAGGGGGCAGTGGGAGGG - Intronic
966302831 3:178497956-178497978 GTGTTGGAGGGGTAGGAGGAGGG - Intronic
966878154 3:184335289-184335311 CTGTTGCCTGGGCAGGGGGAAGG + Exonic
967445301 3:189558922-189558944 ATATGGAAGGGGCAGGAGGGTGG + Intergenic
967597870 3:191349078-191349100 CTGCTGATGGGGGTGGAGGAGGG + Intronic
967707883 3:192673535-192673557 CTGTCAGGGGGGCAGGAGGAGGG - Intronic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968561666 4:1286453-1286475 CAATTGAAGGGTGAGGAGGATGG + Intergenic
968728988 4:2261066-2261088 CTTTTAAGGGGGCGGGAGGAGGG - Intronic
969289144 4:6227574-6227596 CTTTTGAAGGGGAGGGAGAAAGG - Intergenic
969307979 4:6336499-6336521 TTCAGGAAGGGGCAGGAGGAGGG + Intronic
969626085 4:8306484-8306506 CAGTAGGAGGGGCAGGAGCAGGG - Exonic
970864659 4:20744611-20744633 CTGATGAGGGGTCAGGGGGATGG + Intronic
971109833 4:23572717-23572739 CAGTTGAAGGGTGAGGAGGGTGG + Intergenic
972144852 4:36010605-36010627 CTGATGAGGGAGCAGCAGGATGG - Intronic
972238942 4:37167831-37167853 CTGTTGGAGGGGCAGGGGGATGG + Intergenic
972668299 4:41189352-41189374 GTCTGGAAGGGGCAGGAGGAAGG + Intronic
972710742 4:41592062-41592084 AGGGAGAAGGGGCAGGAGGAGGG - Intronic
973627661 4:52789344-52789366 CTGCTGAAGGGGTTGCAGGAAGG - Intergenic
973798020 4:54448811-54448833 TTGGTCAATGGGCAGGAGGAGGG - Intergenic
975228172 4:71899211-71899233 CTGTTGAAGGGGTAGATGGTGGG - Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975848877 4:78551719-78551741 CCGGAGGAGGGGCAGGAGGAAGG + Exonic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
977058535 4:92225183-92225205 CTGTTGAATAGGAAGGAGGGAGG + Intergenic
977937974 4:102827580-102827602 GCGGTGAAGAGGCAGGAGGAGGG - Intronic
978018228 4:103775173-103775195 TTGATCAAGAGGCAGGAGGATGG - Intergenic
978268570 4:106859061-106859083 AGGGTGAAGGGGGAGGAGGAGGG + Intergenic
979921200 4:126498712-126498734 CTGTTGGTGGGTCAGGGGGAAGG + Intergenic
980644087 4:135619181-135619203 CTGGAGAAGAGGCAGGAGGTGGG - Intergenic
981038327 4:140195381-140195403 CTGTACCAGGGACAGGAGGAGGG + Intergenic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
982560457 4:156923214-156923236 CTGGTGAAGGAGCAGCAAGAAGG - Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
985266881 4:188159189-188159211 CTGTCGGTGGGGCAGGGGGAGGG - Intergenic
985744155 5:1637110-1637132 CTGACGCAGGGGCAGGAGGTGGG - Intergenic
985774181 5:1832036-1832058 CTGTTGCAGGGGCACCAAGAGGG + Intergenic
986104211 5:4644290-4644312 CTGCGGAAGCGGCAGCAGGAAGG - Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986746585 5:10750243-10750265 CTGATGAACGGGAAGGAGAATGG + Intronic
987125244 5:14806114-14806136 GTGTTGAAGTGGCAGAAGGGTGG - Intronic
987955249 5:24730211-24730233 TTGTTGAAAGGGCGGGGGGAGGG + Intergenic
989270952 5:39532294-39532316 CTGTTGAAGGGGGAAGCTGAAGG - Intergenic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
991530017 5:67604668-67604690 CACATGAAGGGGCAAGAGGAAGG - Intergenic
991584828 5:68191237-68191259 CTGCTTAGGGGGCAGGAGGCAGG - Intronic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
992335388 5:75762831-75762853 CTGTCAGTGGGGCAGGAGGAGGG - Intergenic
992533716 5:77676751-77676773 ATGTTGAAGGGGAAGGACAAAGG + Intergenic
993150112 5:84151007-84151029 AAGTTGAAGGGGCAGGAAGGAGG + Intronic
993858701 5:93107450-93107472 CTGGGGTGGGGGCAGGAGGATGG - Intergenic
993909257 5:93661427-93661449 CTGTTTCAGGGACAGGAGTAAGG + Intronic
994675321 5:102814023-102814045 CTGTGGTAGGGGCAGGAGACTGG + Intronic
995352348 5:111194145-111194167 GTCTTGGAGGTGCAGGAGGAAGG - Intergenic
996396056 5:123015201-123015223 CTGTTGAATGGGTGGGTGGATGG + Intronic
997460250 5:134047096-134047118 CTTTGGGAGGGGCAGGAGAAAGG - Intergenic
997508267 5:134435339-134435361 CTGTTTAAGGGGCTGAAGGGAGG + Intergenic
997691228 5:135828815-135828837 CTGTAGGAGGGGCAGCTGGAAGG - Intergenic
998214741 5:140228707-140228729 CTGTTGAAGGGGGTGCAGGGCGG - Intronic
998601992 5:143593928-143593950 AGGTTGTAGGGGCAGGTGGATGG + Intergenic
998733971 5:145113629-145113651 ATGTTGAAAGGGGAGAAGGAAGG - Intergenic
999760833 5:154699781-154699803 CTGTTGAAGGGGCATGTGCTGGG - Intergenic
1000134048 5:158327394-158327416 CTGTTGAACTGACTGGAGGAGGG - Intergenic
1000440912 5:161261947-161261969 CTGTGGAAGGTGCAGGAGTGTGG + Intergenic
1001084697 5:168692115-168692137 CTGTTGCAGGGGAAGGGGGCAGG - Intronic
1001249523 5:170136046-170136068 TGGTTGAAGGGCCAGCAGGAAGG + Intergenic
1002103144 5:176867242-176867264 CTACAGACGGGGCAGGAGGAGGG + Intronic
1002163497 5:177331202-177331224 ATGTGCAAGGGGCTGGAGGATGG - Intergenic
1002211974 5:177604617-177604639 CTGGGGCAGGGGCAGGAGGGCGG + Intronic
1002314984 5:178337627-178337649 CTGTAGAGGGGGCAGGAGGTTGG + Intronic
1002521304 5:179794490-179794512 CTTTTTAGGGGGCTGGAGGAAGG - Intronic
1003148740 6:3530976-3530998 TTGGTGAAGAGGCAGGAGTATGG + Intergenic
1003199398 6:3945237-3945259 GTTTTGATGGGGCAGGAGTAAGG - Intergenic
1004460381 6:15829681-15829703 ATGTTGAAGGGGGTTGAGGAAGG + Intergenic
1006457585 6:34140816-34140838 TTGTTGAGGGGACAGGAAGAGGG - Intronic
1006516212 6:34547034-34547056 ATGTGGACGGGGCAGGAGGCAGG - Intronic
1006926299 6:37657353-37657375 CTGTGGAAGGGGCAGAATGATGG - Intronic
1007287109 6:40755567-40755589 CAGGTGAAGGGGGAGGAGGAGGG - Intergenic
1007375129 6:41451334-41451356 CTGTGGAAAAGGCAGGAGGGAGG - Intergenic
1007472399 6:42099371-42099393 CTGATGATGGGGCATGAGCATGG + Intergenic
1007476370 6:42122430-42122452 CTGTTTATGGGCCAGGATGAAGG + Intronic
1007870683 6:45034145-45034167 CTGTTGGAGGAGGAGGAGGTAGG - Intronic
1008234740 6:49030532-49030554 ATGCAGAAGGGACAGGAGGAAGG + Intergenic
1011735613 6:90308115-90308137 CTTTTTAAGAGGGAGGAGGAGGG - Intergenic
1012437918 6:99234776-99234798 CAGCTGAAGGAGCAGGAGAAGGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014439520 6:121458258-121458280 CTACTCAAGAGGCAGGAGGATGG - Intergenic
1015484901 6:133758299-133758321 CTGTTGGAGAGGCTGGAGAAAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016339289 6:143044376-143044398 TTGTTGAGGGGGCAGGGAGAGGG - Intergenic
1016843038 6:148543802-148543824 CTGAAGCAGGGACAGGAGGAGGG + Exonic
1016915884 6:149244229-149244251 CAGTTGAAGGGGTGGAAGGAAGG - Intronic
1017008201 6:150043424-150043446 CTGGGGAGGGGGCAGAAGGAAGG - Intergenic
1017195003 6:151690603-151690625 CTATAGAATGGGCAGGAGAAAGG - Exonic
1017853552 6:158328166-158328188 AAGTTGGAGGAGCAGGAGGAGGG + Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018415781 6:163601080-163601102 CTGTTGATGGGGGTGGGGGATGG - Intergenic
1019262783 7:91501-91523 CAGTTGTAGGGTCAGGAGCAGGG + Intergenic
1019280411 7:196974-196996 CCGCTGCAGGGGCAGGAGAAAGG - Intronic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019463524 7:1173929-1173951 CTACTGATGTGGCAGGAGGAGGG - Intergenic
1019472653 7:1229696-1229718 CGGGGGAAGGGGCAGGCGGAAGG + Intergenic
1019595315 7:1855701-1855723 CTGGTGAGGGCTCAGGAGGAAGG - Intronic
1019737490 7:2657942-2657964 CTCTTGAAGGCACAGGAGGCTGG - Intronic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1022085032 7:27058339-27058361 CTTTGGAAGGGCCAGGAGGGAGG - Intergenic
1022134251 7:27432348-27432370 CTGTTGGAGGGAGAGGCGGAAGG - Intergenic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1023013575 7:35944027-35944049 CTGCAGAAGGGGCCTGAGGAGGG + Intergenic
1023626675 7:42121720-42121742 CTGATGGAGGGGGAGGAGGTGGG - Intronic
1024077553 7:45829807-45829829 CTGCAGAAGGGGCCTGAGGAGGG - Intergenic
1024394116 7:48846703-48846725 AAGTTAAAGGGGCAGGAGAATGG - Intergenic
1024401122 7:48925711-48925733 AGGTTAAAGGGGCAGGAGAATGG + Intergenic
1025014514 7:55428073-55428095 CAGCTGAAGCGGCAGGAGGAAGG + Intronic
1025126857 7:56351605-56351627 CTGCAGAAGGGGCCTGAGGAGGG + Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026435757 7:70396202-70396224 TGGGTGAATGGGCAGGAGGAAGG - Intronic
1026447612 7:70499240-70499262 CTGCTGAAGGGAAAGGAGAAGGG + Intronic
1026945909 7:74316031-74316053 CTGTTGTGGGGGCGGGGGGAGGG - Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027144018 7:75681432-75681454 CTGGTCTAGGGGCAGCAGGAAGG - Intronic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1028776759 7:94685811-94685833 CTGTTGAGGGGGCGGATGGAGGG + Intergenic
1029010069 7:97250445-97250467 CTGTCAGAGGGGCAGGGGGAGGG - Intergenic
1029458019 7:100680701-100680723 CAGTGAAGGGGGCAGGAGGAGGG - Exonic
1030691598 7:112540831-112540853 CTGTTGGAGAGTCAGCAGGAGGG - Intergenic
1030826850 7:114169181-114169203 CTGTTCTGGGGGCTGGAGGACGG - Intronic
1031024806 7:116668758-116668780 GGGGTGATGGGGCAGGAGGAAGG + Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032083695 7:128872820-128872842 CTGGTGATGGGGGAGGAGGGAGG - Intronic
1032460035 7:132103429-132103451 GTGGTGGAGGGACAGGAGGAAGG - Intergenic
1032657480 7:133947288-133947310 AGCCTGAAGGGGCAGGAGGAAGG - Intronic
1033606195 7:142929938-142929960 GTGATGGAGGGTCAGGAGGATGG - Intronic
1033907277 7:146220904-146220926 TATTTGAAGGGTCAGGAGGAAGG - Intronic
1033923598 7:146427889-146427911 CTGTTGGAGGTACAGGGGGATGG - Intronic
1034016946 7:147597705-147597727 GTGATGAAGGGGCTGAAGGATGG - Intronic
1034211627 7:149368683-149368705 CTGTTGTAGGGGGAGGGGGAGGG - Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1036020465 8:4839154-4839176 CTGATGAAGGGAAAGAAGGATGG - Intronic
1036759336 8:11496568-11496590 CTGTGGCAGGGGCTGCAGGACGG + Intronic
1036985196 8:13521245-13521267 CTGTTGGAGGGGCTTGGGGAGGG + Intergenic
1037069508 8:14626302-14626324 CTGTTGAGGGGGTTGGGGGAGGG - Intronic
1037374992 8:18217829-18217851 CTGTTGCAGGGGCTGGTGCAGGG + Intronic
1037476783 8:19265473-19265495 CTCTTGAAGGGCGTGGAGGAAGG + Intergenic
1037562408 8:20086935-20086957 CTGTTGCAGGGACAGGAAGTGGG - Intergenic
1037637098 8:20710013-20710035 CTGTTGCGGGGGCAGGAGGAGGG - Intergenic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037948101 8:23001834-23001856 CTGCTGAAGGGGCTGGGGAATGG + Intronic
1038284697 8:26196501-26196523 CTGGAGATGGGGCGGGAGGAGGG - Intergenic
1038699180 8:29834231-29834253 CTGTTGAGGGGGTGGGAAGAGGG - Intergenic
1039433492 8:37543906-37543928 CTGATGAAGGGGCAGGCCCAAGG + Intergenic
1040546442 8:48401626-48401648 CTGCAAAAGGGGTAGGAGGAAGG + Intergenic
1041153290 8:54958060-54958082 CTCTTGAAGGGAAAGGAGGATGG - Intergenic
1041180942 8:55247287-55247309 CAGTTTAAGGGGCAGGAAAAAGG - Intronic
1041364644 8:57089133-57089155 CTGTTGGAGGGGTGGGGGGAGGG - Intergenic
1041380190 8:57246674-57246696 CAGTTGAAGGTGAAGGAGGTGGG + Intergenic
1041641381 8:60206657-60206679 ATGATGAAGGGGCAGGAGCTAGG - Intronic
1041703222 8:60815445-60815467 CTGTTTGAGGGGCAGGGAGAGGG + Intronic
1043631159 8:82336120-82336142 TTGTTGAGGGGACAGCAGGAGGG - Intergenic
1043796395 8:84547113-84547135 CTGTTGGGAGGGCAAGAGGAGGG - Intronic
1044420979 8:91995542-91995564 CTTTGGAAGGCTCAGGAGGAAGG + Intronic
1046619601 8:116514406-116514428 GTGTTGAAGAGACAGGAAGAAGG - Intergenic
1046737872 8:117796312-117796334 CTGTTTAAAGGGCAGGATCAGGG - Exonic
1047190001 8:122669691-122669713 TTGGGGAAGGGGCAGGATGAGGG - Intergenic
1047459718 8:125051017-125051039 TTTTTGGAGGGGCAGGATGAAGG + Intronic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1048572810 8:135669273-135669295 CTGCTGCAGGGCCAGGCGGAGGG - Intergenic
1049009388 8:139877218-139877240 CAGTGGAAGAGGCAGGCGGAGGG + Intronic
1049033831 8:140059103-140059125 GTTGTAAAGGGGCAGGAGGAAGG - Intronic
1050428732 9:5539618-5539640 CTGAGGAAGGGGCGGGAGCATGG + Intronic
1050478451 9:6064880-6064902 TTGCTGAAGGGGCATGAGGAAGG + Intergenic
1051328737 9:16000901-16000923 CCTTTGATGGGGGAGGAGGATGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052054622 9:23890370-23890392 CTGTTGAAGGTGTAGGGAGAGGG - Intergenic
1052135055 9:24898847-24898869 ATGTGGTAGGGGCAGGAGCAAGG + Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052751935 9:32500843-32500865 CTGTTGGAGCTCCAGGAGGAAGG - Exonic
1052939529 9:34121630-34121652 CTCTTGAAGGGGCTGGGGGTGGG - Intronic
1053000551 9:34575105-34575127 CTCTTGAATGGAGAGGAGGAAGG + Intronic
1053000895 9:34576926-34576948 CTGCAGAAAGGGCAGGAGAAGGG + Intronic
1053021090 9:34694764-34694786 GGCTTGAAGGGGCAAGAGGAGGG - Intergenic
1053402750 9:37841145-37841167 CAGATCCAGGGGCAGGAGGAAGG + Intronic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1055580807 9:77704541-77704563 CTGTTGGAGGAGTAGGGGGAAGG + Intergenic
1055583860 9:77735670-77735692 CTGTTGTTGGGGCGGGAGGTGGG + Intronic
1056057568 9:82843230-82843252 CTGTCGAGGGGTCAGGGGGAGGG + Intergenic
1056184616 9:84121362-84121384 CTTGTGAAGAGGCAGCAGGAGGG + Intergenic
1056365484 9:85900104-85900126 CTGATGTAGGGGCAGAAGGAAGG - Intergenic
1056968381 9:91183003-91183025 CTGGTGCAGGAGCAGGAGGGAGG - Intergenic
1057040505 9:91844353-91844375 CTGTGGAAGGTGCAGGAGCGTGG - Intronic
1057608918 9:96523355-96523377 AAGTTAAAGGGGCAGGAGAATGG - Exonic
1057755986 9:97835944-97835966 CAGTTGAAGGATCAGGAAGAGGG + Intergenic
1059538202 9:115103817-115103839 CTGTTCAAGGGGCAGGAGGGAGG - Intronic
1059583795 9:115583070-115583092 CTGTTGACGAGGCAGGGGGTTGG - Intergenic
1060409302 9:123389519-123389541 CTGTGGAAGTGGCAGGAGCCAGG - Intronic
1060824601 9:126680749-126680771 CTAGTGAAGGGGCAGAAAGAAGG + Intronic
1060825953 9:126688314-126688336 CTGGGGAAGGGGCAGCAGGGCGG - Intronic
1061238036 9:129353268-129353290 CTGATGAAGGGGCTGGTGGGAGG + Intergenic
1061397726 9:130352711-130352733 GTGTGGAAGGTGCAGGAGGTGGG - Intronic
1061407028 9:130398227-130398249 CTGTTGGAGGGGGAGGAGACTGG - Intronic
1061491861 9:130949388-130949410 CTCTTGAAGGGGCTGCAGGTGGG + Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1062174402 9:135153017-135153039 CAGTTGGAGGGGCAGCAGGGAGG - Intergenic
1062460094 9:136659400-136659422 CTGCAGGAGGTGCAGGAGGAGGG - Exonic
1062622999 9:137431000-137431022 CTCTTCAAGGTTCAGGAGGAGGG + Intronic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1187157360 X:16733466-16733488 CTGTTGAAGGGGCAGGCAGGTGG - Intronic
1187178247 X:16916624-16916646 CTGTTGGGGGGGGAGGGGGAGGG - Intergenic
1187507410 X:19888172-19888194 CTGTTGGAGGGGAAGGAAAAGGG + Intergenic
1187699042 X:21947187-21947209 ATGCTGAAGGAGCGGGAGGAAGG - Intronic
1189990896 X:46593904-46593926 CTATTTAAGGGGCAGGATAAAGG - Intronic
1190437306 X:50438213-50438235 GGGTGGAAGGGGCAAGAGGAGGG - Intronic
1192157329 X:68756400-68756422 CTGTTGAAGGGACAGCATGAGGG + Intergenic
1192269646 X:69566673-69566695 CTGGAGAAGGGGCAGGTGTAGGG + Intergenic
1192432091 X:71119264-71119286 AAGGTGAAAGGGCAGGAGGAGGG - Intronic
1193664190 X:84296132-84296154 CTGTTGCGGGGGCTGGAGAAGGG - Intergenic
1193849313 X:86516706-86516728 CTTGAGAAGGGGCAGGAAGAGGG - Intronic
1194113221 X:89864096-89864118 CTGTTTAAGTTGCAGGAGAAGGG - Intergenic
1194515942 X:94854483-94854505 CTGTTGTGGGGGCATGATGAGGG + Intergenic
1194989511 X:100531333-100531355 CTGTTGGAGGGGTAGCGGGAGGG - Intergenic
1195355287 X:104033700-104033722 CTGAGGAAGGGGCAGGAAGGAGG + Intergenic
1195504534 X:105642161-105642183 ATGTTGATGGGGCAGGAGTGAGG - Intronic
1195901190 X:109799115-109799137 CTCTAGAAGGGGAAGGAGTAGGG - Intergenic
1195923175 X:110002639-110002661 CTGCTGCAGGGGGAGGAAGACGG + Intronic
1195961799 X:110394763-110394785 CAGTTGAAGAGGCAGAAGCACGG - Intronic
1196283950 X:113857910-113857932 CTGTTGGAGTGGCAGGGGGAGGG - Intergenic
1196373157 X:115001153-115001175 CAGTTTTAGGGGCAGGAAGATGG + Intergenic
1196857524 X:119998445-119998467 CTGTTGACCAGGCTGGAGGAGGG + Intergenic
1197160156 X:123313876-123313898 CTGGAGAAGGGGCAGCAGGGTGG + Intronic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197699557 X:129588568-129588590 CTGTTGACAGGGCAGGGAGAAGG + Intronic
1197727978 X:129788755-129788777 ATCTTGACGGGGCAGGAGGCTGG + Intronic
1199293247 X:146128958-146128980 ATGTTGAAAGGACAGGAGAAAGG - Intergenic
1199411478 X:147528621-147528643 CTGATGGGGGGGGAGGAGGAGGG - Intergenic
1199436206 X:147815406-147815428 GTGCTGAAGGTCCAGGAGGATGG - Intergenic
1200049341 X:153420489-153420511 GAGATGAAGGGGCGGGAGGATGG - Intronic
1200465906 Y:3519155-3519177 CTGTTTAAGTTGCAGGAGAAGGG - Intergenic
1201856297 Y:18548075-18548097 AGGTTGAAGGTGAAGGAGGAGGG - Exonic
1201877024 Y:18772309-18772331 AGGTTGAAGGTGAAGGAGGAGGG + Exonic