ID: 909308841

View in Genome Browser
Species Human (GRCh38)
Location 1:74119693-74119715
Sequence GAGTATTATTTTAATTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909308841_909308848 21 Left 909308841 1:74119693-74119715 CCCACCAAATTAAAATAATACTC No data
Right 909308848 1:74119737-74119759 TTATATACACAGCTCTTTTTAGG 0: 1
1: 0
2: 1
3: 22
4: 284
909308841_909308850 23 Left 909308841 1:74119693-74119715 CCCACCAAATTAAAATAATACTC No data
Right 909308850 1:74119739-74119761 ATATACACAGCTCTTTTTAGGGG 0: 1
1: 1
2: 0
3: 14
4: 201
909308841_909308849 22 Left 909308841 1:74119693-74119715 CCCACCAAATTAAAATAATACTC No data
Right 909308849 1:74119738-74119760 TATATACACAGCTCTTTTTAGGG 0: 1
1: 0
2: 1
3: 22
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909308841 Original CRISPR GAGTATTATTTTAATTTGGT GGG (reversed) Intronic
No off target data available for this crispr