ID: 909314310

View in Genome Browser
Species Human (GRCh38)
Location 1:74196756-74196778
Sequence CAGTGGGAATGGTGAGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 1, 2: 7, 3: 83, 4: 526}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909314310 Original CRISPR CAGTGGGAATGGTGAGAAGT TGG (reversed) Intronic
900282348 1:1878910-1878932 CAGAGGGAATGGTCCGAAGTTGG - Intronic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
900682322 1:3923874-3923896 CACTGGGAAGCGTGAGGAGTGGG - Intergenic
901175585 1:7296467-7296489 TAGTGGGGATGGGAAGAAGTGGG + Intronic
902340670 1:15781626-15781648 AAGTAGAAATGGTGAGATGTGGG - Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
902647671 1:17813240-17813262 CATAGGTAATAGTGAGAAGTAGG - Intronic
903016938 1:20367305-20367327 CGGTGGGACTGGGGAGATGTAGG - Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
904274799 1:29374128-29374150 TTTTGGGAATGGTGAGAAATAGG + Intergenic
904309772 1:29621236-29621258 CAGTGGGAATGGGAAGGAGAAGG + Intergenic
904391333 1:30188254-30188276 CTGTGGGAATGGTGTGACGCTGG - Intergenic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906264987 1:44421792-44421814 CAGTGGGAGAGGTGGGGAGTAGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907875951 1:58488774-58488796 CAGGGGAAACAGTGAGAAGTGGG - Intronic
908777336 1:67653249-67653271 CAGTGGAAGTGGGGAGGAGTAGG - Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909814235 1:79971143-79971165 AAGTGATAATAGTGAGAAGTTGG + Intergenic
910289588 1:85587544-85587566 GAGGGTGAATGGTAAGAAGTAGG - Intergenic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
911006081 1:93226020-93226042 GAAAGGGAGTGGTGAGAAGTTGG - Intronic
911047919 1:93643637-93643659 CAGAGGAAATGGGGAGATGTAGG + Intronic
911433430 1:97823471-97823493 GAGTGGAAATGGGGAGAGGTTGG - Intronic
911672022 1:100618409-100618431 GACTGGAAATGGTGACAAGTTGG - Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
912121059 1:106472890-106472912 CAGTGGGCAAGGTGGCAAGTGGG + Intergenic
912428943 1:109618913-109618935 CTGTGGGAGTGGTAAGAACTGGG + Intronic
912865467 1:113252410-113252432 AAGTGGTAATGGAGATAAGTGGG + Intergenic
912921764 1:113875213-113875235 AAGTGGGAATGGGGCTAAGTGGG - Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913311549 1:117501307-117501329 CAGTGGAAGTGATGAGAAGAGGG + Intronic
914355954 1:146884827-146884849 CACTGGGGATGGTGGAAAGTGGG - Intergenic
914445649 1:147748631-147748653 CAGTGGAAATGCTCAGAAGAAGG + Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915636397 1:157189964-157189986 GAGTGGAAGTGGTGAGAGGTGGG + Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
916016150 1:160751286-160751308 CAGTGGAAGTGGTGAGTGGTTGG + Intronic
916612652 1:166408524-166408546 CAGTGAGAATGGAAACAAGTTGG - Intergenic
916784864 1:168079255-168079277 TCTTGGGCATGGTGAGAAGTAGG + Intergenic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
919612058 1:199757803-199757825 TAGCAGGAATGGTGAGAAGAAGG - Intergenic
920067364 1:203278405-203278427 CAGCAGGAAGGGTGAGAATTTGG - Intergenic
920186773 1:204164348-204164370 AAGTGGGAATGCTGAGTTGTTGG + Intronic
920231764 1:204475426-204475448 CAGTGGAAATGATGGGAATTTGG - Intronic
921984708 1:221299964-221299986 CAGGGGGAATGAAGAGAGGTGGG - Intergenic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
923230481 1:231981929-231981951 CAGTTGGTATGTAGAGAAGTGGG + Intronic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923291608 1:232551587-232551609 CAGTGGGGGAGGTGAGAAGAAGG + Intronic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
1063479014 10:6354869-6354891 GAGTGGGAAGAGTGAGAATTTGG + Intergenic
1063655772 10:7986958-7986980 CTGGGGGAAGGGTGAGATGTGGG - Intronic
1064511636 10:16100388-16100410 CAGTGTGAATGTTGAGAAGTGGG + Intergenic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1065967506 10:30781611-30781633 CAGTGGCAATGGGGACCAGTGGG - Intergenic
1065975936 10:30842437-30842459 CATTGAGAATGGTGGGAAGAGGG - Intronic
1068714866 10:60177005-60177027 CAGTGGAGATGGTGAAATGTAGG - Intronic
1068815714 10:61309378-61309400 TAGGGGAAATGGTGAGATGTTGG - Intergenic
1069222256 10:65898948-65898970 CAGTGGAAAAGGTCAGAAATTGG + Intergenic
1069262031 10:66410601-66410623 CAGAGGGAAAGGTCAGGAGTGGG - Intronic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069615729 10:69805049-69805071 CAGAGGGAATTGGGAGAACTGGG + Intronic
1069714581 10:70512495-70512517 CAGTGGCAGTGGTTAGAATTAGG + Intronic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070224139 10:74483001-74483023 CTATTGGAATGGTGAGAAGAGGG - Intronic
1070454096 10:76592459-76592481 AAATGGGGATGGTGAGAGGTGGG - Intergenic
1070485880 10:76930993-76931015 CAGGGGGAATGGGGAGATGTTGG + Intronic
1070917519 10:80164335-80164357 CAGTGGCAGTGGTGATGAGTAGG + Intronic
1071272328 10:84019731-84019753 CATTGGGACTGGTTAGATGTGGG + Intergenic
1071893987 10:90044167-90044189 CAGTTGGATTGGTGACAACTTGG + Intergenic
1072114529 10:92357508-92357530 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1072667693 10:97406260-97406282 CAGTGGGAAGGCTGAGAAAAGGG + Intronic
1072771639 10:98144903-98144925 TGGAGGGAATGGTGTGAAGTTGG + Intronic
1073170580 10:101504525-101504547 CAGTGGGGTTGGTGAGAGATGGG - Intronic
1073821792 10:107272678-107272700 GACTGGGAAAGGAGAGAAGTTGG - Intergenic
1073924768 10:108502807-108502829 CAGTAGGAAAGTTTAGAAGTAGG + Intergenic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074388669 10:113037962-113037984 AAGTGAGAATGGGAAGAAGTTGG + Intronic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1076156196 10:128207474-128207496 GACTTGGAAGGGTGAGAAGTGGG + Intergenic
1076487346 10:130832956-130832978 CAGTGGGAAATGTGAGATCTTGG - Intergenic
1077348021 11:2073305-2073327 CACTGGGAATGATGGGAAGCGGG + Intergenic
1077826536 11:5815584-5815606 CAGTGAGAATGTAGAGAAATTGG + Intronic
1078151295 11:8761667-8761689 GCGTGGGAAGGGTGAGAAGGAGG - Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078813954 11:14800754-14800776 CAGGGGGAATGGAGCCAAGTTGG - Intronic
1080285460 11:30606324-30606346 CAGTGCTATTGGTGAGAAATGGG - Intergenic
1080360499 11:31507667-31507689 CAGGGGGGATGGGGAGAATTTGG + Intronic
1081284334 11:41248988-41249010 CAGTGGCTATAGTGAGAAGTGGG - Intronic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083078230 11:60063861-60063883 CAGGGGGAAAGGTGGGAAGGAGG + Intronic
1083698872 11:64461101-64461123 CACTGGGAATGGTGGGGAGGTGG + Intergenic
1083902834 11:65652037-65652059 CAGTGACAGTGGGGAGAAGTGGG + Intergenic
1083958693 11:66002087-66002109 CAGTTGGACTGGTGGGAACTGGG - Exonic
1084591675 11:70094135-70094157 CCCTGGGAGTGGTGAGGAGTGGG - Intronic
1084770902 11:71342283-71342305 CAGTGGAGAACGTGAGAAGTGGG + Intergenic
1085188471 11:74596745-74596767 GAGGGGGAATGGGGAGATGTGGG - Intronic
1085630544 11:78112297-78112319 GAATAGGAATGGTGAGAAGGGGG + Intronic
1087104691 11:94398002-94398024 CAATGTGAAGGGTGAGAAGTTGG - Intronic
1087979174 11:104590084-104590106 CAGTGGGCATGATGGGACGTGGG - Intergenic
1090180744 11:124697089-124697111 CAATGGAAGTGGTTAGAAGTAGG - Exonic
1090248631 11:125235877-125235899 CAGTGGGCAGACTGAGAAGTAGG - Intronic
1090642223 11:128739545-128739567 CCTTGGGAATGGAGAGTAGTGGG - Intronic
1090799896 11:130163844-130163866 CAGTGGAAATGGTCAGAGGGTGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091505049 12:1059373-1059395 GAGTAAGAATGGTGAAAAGTTGG + Intronic
1091569180 12:1669626-1669648 GAATGGGAATGGGGAGAAGTAGG + Intergenic
1091669788 12:2444817-2444839 TAGTGGGATTGGTGAGATGTAGG - Intronic
1092120944 12:6043448-6043470 CAAAGTGAATGGTGAGGAGTTGG - Intronic
1092749456 12:11705036-11705058 CGGTGGAAATGGGGAGATGTGGG + Intronic
1092927144 12:13281624-13281646 CAGTGATCATGGTGAGAAATGGG - Intergenic
1093402213 12:18760763-18760785 CATTGGGACTGGTTAGATGTTGG + Intergenic
1093518153 12:20015757-20015779 CAGAGAGAATGGTGTGAAGATGG - Intergenic
1094032733 12:26031625-26031647 CAGTAAGAATGGTAAGTAGTTGG + Intronic
1094664923 12:32510194-32510216 TAGTGGGAATGGGAAGAAGTGGG + Intronic
1094874143 12:34622056-34622078 CATTGGGAATGGTGACAAAAAGG - Intergenic
1096039166 12:48499542-48499564 GAGTGGAAGTGGTGAGAAATGGG - Intergenic
1096739876 12:53685274-53685296 TAGTGGGGATGGTGAGGAGTAGG + Intergenic
1097188313 12:57207647-57207669 CAGTGGGAATGGTCAGCAGCTGG + Intronic
1097295286 12:57956443-57956465 CAGTGGGAAAGATGAGAAAATGG + Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1098275069 12:68804807-68804829 CAGTGGGAAGGAGGAGAAGGGGG + Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098469398 12:70826309-70826331 TAGTGGGAAAGGTGAGAAGAGGG + Intronic
1099168676 12:79338189-79338211 CAATGGAAATGGTGAAAAATGGG - Intronic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1101010208 12:100441566-100441588 GAGTGGAAGTGGTGAGAAATGGG + Intergenic
1101471471 12:105000646-105000668 CAGTGTGGATGGTAAGAATTTGG + Intronic
1101544070 12:105694170-105694192 CAGGGGGAAGGGTGAGAAGTGGG - Intergenic
1101730443 12:107422601-107422623 CAGTGGAGGTGATGAGAAGTTGG + Intronic
1101784404 12:107870302-107870324 GAGAGGGAATGGAGAGACGTAGG + Intergenic
1102392758 12:112562904-112562926 CAGTAGGGATAGGGAGAAGTGGG - Intergenic
1104588802 12:130068203-130068225 CAGTTTTAATGATGAGAAGTTGG + Intergenic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1104830539 12:131747815-131747837 CAGTGGGAATGTTGAGTAGGTGG + Intronic
1104919767 12:132284788-132284810 TTGTGGGAAGGGTGTGAAGTGGG + Intronic
1106273183 13:28174507-28174529 CAGTGAGATGGGTGAGATGTAGG + Intronic
1107007510 13:35630936-35630958 AGGGGGGAATGGTGGGAAGTGGG - Intronic
1107021020 13:35751698-35751720 CGGGGGAAAGGGTGAGAAGTGGG + Intergenic
1108148148 13:47501327-47501349 CAGTGGCAGTGGGGAGAAATGGG - Intergenic
1109287420 13:60426287-60426309 CAGAGGAAATGGGGAGATGTGGG + Intronic
1109507889 13:63331007-63331029 GGGTGGGAAGGGTGAGAAGGGGG - Intergenic
1109712301 13:66177644-66177666 CAAAGGGAATGGTGAGAACAAGG + Intergenic
1110009274 13:70311386-70311408 GAGTGTCAATGGAGAGAAGTTGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110390393 13:74966970-74966992 CAGCGGGAAGTGTGAGAAGCTGG + Intergenic
1110642500 13:77841738-77841760 TAGTGAGAATGGGGAGAAATTGG - Intergenic
1111024171 13:82497602-82497624 CAATGAGAATGGGGAGAAATTGG - Intergenic
1111276596 13:85956090-85956112 CATTGGGAAGGCTGAGAAGTAGG + Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1114477625 14:23008100-23008122 CAGTGGCAATGGTGCGATCTTGG - Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1117114176 14:52492784-52492806 AAGGGGGAATGGTGAGAAGGTGG - Intronic
1117195758 14:53338568-53338590 CACTGGGAATGGTGTCAGGTGGG - Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118168390 14:63360388-63360410 GAGTGTGAATGCTAAGAAGTGGG - Intergenic
1118877839 14:69799383-69799405 CAGAGGGAATGGGAAGGAGTGGG - Intergenic
1118906165 14:70024972-70024994 TAAGGGGAATGGAGAGAAGTGGG + Intronic
1119783733 14:77297043-77297065 TGGTGGGAATGGTGGGAACTCGG + Intronic
1119994649 14:79240009-79240031 TAGGGGGAATGGAGAGATGTTGG + Intronic
1120949120 14:90024572-90024594 CAGTGGGTATTGTGTGCAGTAGG + Intronic
1121456342 14:94041106-94041128 CAGTGGGCATGGCAAGAAGTGGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121963342 14:98281664-98281686 CAGTGAAAATGCTGAGAAGATGG + Intergenic
1123509361 15:20981081-20981103 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123566583 15:21554821-21554843 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123602844 15:21992114-21992136 CAGTGGGGATGGGGAGATATTGG - Intergenic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1124713567 15:32034984-32035006 CTGTGGGAATGTGGAGAAGGGGG + Intronic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125594136 15:40873672-40873694 CAGCGGGACAGGTGAGAAGCTGG - Exonic
1125890681 15:43264142-43264164 TAGTGGGAATGCAGAGAAATTGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128976393 15:72156746-72156768 CCCTGGGAATAGTGAGGAGTGGG + Intergenic
1129525583 15:76211835-76211857 CATTGGGACTGGTGAGAGGGAGG - Intronic
1129909539 15:79214707-79214729 CAGTGGGAGTGGTGGGAGGCTGG + Intergenic
1130255199 15:82322741-82322763 CTGTGGCAGAGGTGAGAAGTGGG + Intergenic
1130332555 15:82933554-82933576 CTGTGAGAATGATGAGAAGGTGG - Intronic
1130599775 15:85267265-85267287 CTGTGGCAGAGGTGAGAAGTGGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131961179 15:97791836-97791858 CCGTGAGATTGGTGAGAATTGGG - Intergenic
1132024170 15:98390825-98390847 CAGTGGGGTGGGTGAGTAGTTGG - Intergenic
1202974944 15_KI270727v1_random:281916-281938 CAGTGGGGATGGGGAGATATTGG - Intergenic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1134297952 16:12963232-12963254 GAGTGGGAATGGTGAGGACATGG + Intronic
1134599165 16:15519891-15519913 CCCAGGGAATGGTGAGAACTCGG + Intronic
1135141401 16:19925191-19925213 CAGTGAGGATGTTGAGAAATAGG - Intergenic
1135165139 16:20132446-20132468 CAGTGGTTATCATGAGAAGTGGG + Intergenic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1138309297 16:56009499-56009521 CAGGGAGAATGGTGGGCAGTAGG + Intergenic
1138363924 16:56456926-56456948 CAGTGGAAGTAGTAAGAAGTGGG - Intronic
1138673868 16:58636811-58636833 CGGTGGGAATGGGGAGAACTGGG + Intergenic
1139197029 16:64931182-64931204 GGGTGGAAATGGGGAGAAGTAGG + Intergenic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1139978062 16:70830634-70830656 CACTGGGGATGGTGGAAAGTGGG + Intronic
1140051080 16:71481791-71481813 CAGAGGGAATTGTGAGAACGAGG - Intronic
1141118233 16:81330092-81330114 CAGTGGCAATGGTGAAGAGAAGG - Intronic
1141303187 16:82837147-82837169 GAGGGTGAATGGTGGGAAGTGGG + Intronic
1142294759 16:89213288-89213310 CAGGGAAAATGTTGAGAAGTAGG + Intergenic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1142888845 17:2929974-2929996 CAGAGGGAAGGGTGAGCAGGTGG - Intronic
1143042973 17:4053033-4053055 CAGTGAGAATGAACAGAAGTGGG - Intronic
1143418190 17:6765769-6765791 TAGGGGGCAAGGTGAGAAGTAGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1145034138 17:19528420-19528442 AAGCTGGAATGGTGAGAACTCGG - Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1145964393 17:28906595-28906617 CAGTTGGAATGGGGAGATGCAGG - Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147981945 17:44280195-44280217 CAGCTGGAAGGGTCAGAAGTGGG - Intergenic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148705206 17:49624142-49624164 GAGTGGGACTGGGGAGATGTAGG + Intronic
1150837149 17:68574507-68574529 ATGTGGCAATGTTGAGAAGTGGG - Intronic
1150911494 17:69392385-69392407 CAGGGGAAAGGGTGAGAGGTGGG - Intergenic
1152274665 17:79349294-79349316 GAGTGCGAGTGGTGAGAGGTGGG - Intronic
1154127465 18:11704443-11704465 AAGTGGGAATAGTGAGGAATGGG + Intronic
1154429127 18:14294903-14294925 AGGTGGGTAGGGTGAGAAGTAGG + Intergenic
1155559487 18:27060511-27060533 GAGTGGGAATGTTGAAAAGAGGG + Intronic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1156861952 18:41847236-41847258 CAGGGGGAGTGGTTACAAGTAGG + Intergenic
1158433542 18:57415828-57415850 CAGGAGGCAAGGTGAGAAGTTGG - Intergenic
1159553048 18:69917029-69917051 AAGTGGGAAAGCAGAGAAGTAGG - Intronic
1159763080 18:72452953-72452975 GAGGGGAAATGGTGAGATGTTGG + Intergenic
1160146918 18:76372786-76372808 CAATGGGAATATTGAGTAGTCGG - Intronic
1161446815 19:4323303-4323325 CAGTGGGACCGGTCAGAAGTGGG - Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162241809 19:9361279-9361301 CAGTGGGAATTGTCAGCAGCAGG + Intronic
1162309704 19:9898810-9898832 TAGCTGGAATGGTGAGCAGTGGG - Intronic
1163228890 19:15985392-15985414 GAGAGGAAATGGTGAGATGTTGG + Intergenic
1163314348 19:16532061-16532083 CAGTGGGAAGGGTGAGGGCTGGG + Intronic
1164676104 19:30102845-30102867 CTGTGAGGATGGTGAGAAGCTGG - Intergenic
1165491500 19:36126043-36126065 AGGTGGGAATGATGAGAAGATGG - Intergenic
1165843522 19:38803686-38803708 GAGTGGGAATGGTGAGAATTGGG - Intronic
1165856399 19:38881242-38881264 CAGTGGGAGTTGGGAGCAGTGGG + Intronic
1166559766 19:43724596-43724618 CAGTGGAAATGCTGAGAAATTGG + Intergenic
1167428797 19:49442857-49442879 CAGTGGCGAGGGTCAGAAGTCGG - Intergenic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
1168119875 19:54245930-54245952 CAGTGGGACTGCTGAGATCTAGG + Intronic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925587336 2:5476500-5476522 CAGTTGGAAGGGTGTGAGGTGGG - Intergenic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
926591962 2:14749891-14749913 TAGGGGGAATGGTGAGGAATGGG + Intergenic
926940587 2:18132040-18132062 AGGTGGGAATGGGGAGAATTTGG + Intronic
927043954 2:19258176-19258198 CGGTGGGGAAGGTGAGGAGTGGG + Intergenic
927868470 2:26608261-26608283 GAGTGGGTCTGGTGAGAAGGGGG + Intronic
928034642 2:27810738-27810760 AAATGGGGATGCTGAGAAGTGGG - Intronic
928239916 2:29577429-29577451 CAGTCTGAATGGTGGGAAGGTGG + Intronic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930151974 2:48068611-48068633 CAGTGGTAATGGCGAGTGGTGGG + Intergenic
930907566 2:56590609-56590631 CAGTCTCAATAGTGAGAAGTGGG - Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
932247564 2:70208206-70208228 CAGAGGGAATGGTGGCCAGTTGG + Intronic
932356064 2:71069093-71069115 GAGTGGGAGTGGGGAGAAGCGGG + Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
935482139 2:103603482-103603504 CAGTGGGAATGGAGAGAGTGAGG + Intergenic
935673064 2:105571961-105571983 GAGAGGGAAAGGTGAGAAGGGGG - Intergenic
936504018 2:113090360-113090382 ATTTGGGAAGGGTGAGAAGTGGG + Intergenic
936719575 2:115234608-115234630 CAGTGTGCATGGTGAGAAGGTGG - Intronic
936755957 2:115712487-115712509 CATTGCGAATGTTGAGAACTAGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936919805 2:117676278-117676300 CAGTGGGGAGGGTGAGAACAGGG + Intergenic
937025045 2:118690763-118690785 CAGGGGGATTGAGGAGAAGTTGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937436832 2:121887991-121888013 CTATGGGGATGCTGAGAAGTGGG + Intergenic
937817308 2:126265826-126265848 TAGTGGGAATAGGGAGATGTTGG - Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938270262 2:129964024-129964046 CATTGGGAATGGGGAGAAAAAGG - Intergenic
938611033 2:132948012-132948034 CTGTGAGGATGCTGAGAAGTTGG - Intronic
938693577 2:133815193-133815215 CAGTGGGAATGGGGACCACTGGG - Intergenic
939450455 2:142367062-142367084 CAGTGGGATGGATGAGAAGCTGG + Intergenic
940842076 2:158595301-158595323 CAATAAGCATGGTGAGAAGTAGG - Intronic
941134737 2:161700103-161700125 TATTGGGAATGGTGAGCTGTTGG + Intronic
941724426 2:168845624-168845646 CACTGGGAATGCTGAGAAGGGGG - Intronic
942503050 2:176612140-176612162 GAGTGAGAATTGTGGGAAGTGGG - Intergenic
943409955 2:187534112-187534134 CAGGGAGAATGGAAAGAAGTTGG + Intronic
943456528 2:188114982-188115004 CAATGGGAAAGGTTAGAGGTAGG - Intergenic
943752075 2:191519886-191519908 CAGTGGAAATGATGGGAAGCAGG - Intergenic
944101603 2:196033439-196033461 CAGGGGGAATGGGGAGATGATGG - Intronic
944386574 2:199171502-199171524 CGGGGGAAAGGGTGAGAAGTGGG + Intergenic
945071151 2:205990302-205990324 CAGTGCAAATGTTGAGAGGTGGG + Intergenic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
946272232 2:218603930-218603952 CAGTGGCAATGGCGTGAACTTGG + Intergenic
946512219 2:220370379-220370401 CAGTGCAGGTGGTGAGAAGTGGG - Intergenic
947040429 2:225912174-225912196 GAGTGGGAATGGACAGCAGTGGG - Intergenic
947202209 2:227624071-227624093 CAATGGAAATGCTGAGTAGTAGG + Intronic
947937550 2:234021154-234021176 CAATGGGAGAGGTGAGAACTTGG - Intergenic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948551600 2:238776244-238776266 CAGTGGGGAAGGGGAGATGTCGG + Intergenic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1171094882 20:22322636-22322658 CTGCTGGAATAGTGAGAAGTTGG + Intergenic
1172428422 20:34871933-34871955 CTGCTGGAATTGTGAGAAGTGGG - Intronic
1172477627 20:35250745-35250767 CAGGGGGAAGAGTGAGAAGGGGG + Intronic
1173350550 20:42241369-42241391 AAGTGGGAATGGCAAGATGTTGG + Intronic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1174530918 20:51213293-51213315 CACTGGGGTTGCTGAGAAGTGGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175905745 20:62378537-62378559 CAGTGGGAATGGCGGGATTTCGG - Intergenic
1176023308 20:62973487-62973509 CAGTGGGCTTGGGGAGAAGCCGG - Intergenic
1178009994 21:28273733-28273755 CATTGAGAATGGTTAGAAGTGGG - Intergenic
1178231407 21:30789196-30789218 TAGAGGAAATGGGGAGAAGTAGG - Intergenic
1178600558 21:33990856-33990878 CTCTGGGAATGGTGAGAGCTGGG + Intergenic
1179252752 21:39686759-39686781 CAGTGAGATTGGTGAGATGTAGG + Intergenic
1180629803 22:17220666-17220688 GAGTGGGACTGGGGAGGAGTGGG - Intronic
1180708136 22:17822175-17822197 CAGAGGGAAGGGGCAGAAGTGGG + Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1182882747 22:33747544-33747566 CAATGGGCTTGGTGAGGAGTGGG - Intronic
1183029437 22:35092389-35092411 CAGTGGGCAAGGTGAGAACAGGG - Intergenic
1183842035 22:40506760-40506782 CAGTGAAAATGGTGATAAATGGG - Intronic
1183878611 22:40806186-40806208 CAGGGGGAAAGCTGTGAAGTGGG + Intronic
949531949 3:4964887-4964909 CTGTGGGACAGGTGAGAAGAAGG + Intergenic
950097550 3:10338762-10338784 CTCTGGGCATGGTGAGAACTGGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
951534676 3:23729862-23729884 GAGTGGGCAGGGTGAGAAGTAGG - Intergenic
951991390 3:28679340-28679362 CAGGAGGAATGGGGAGAAGAGGG - Intergenic
952054931 3:29432820-29432842 GAATGGGAAGGGTGAAAAGTTGG + Intronic
952439762 3:33314308-33314330 CAGGGGAAATGGGGAGATGTTGG - Intronic
953421965 3:42761224-42761246 CAGTGGGAATGGAGACATGGGGG - Intronic
953829034 3:46279439-46279461 CAGTGGGAATGGGGATATCTGGG + Intergenic
953849485 3:46455071-46455093 CCGTGGGGCTGGTGAGAAGTTGG + Intronic
954674319 3:52307356-52307378 CAGTGGGAATGATGGGAGGCTGG + Intergenic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
954971155 3:54652723-54652745 CAGTGGGCACAGTGAGATGTTGG + Intronic
955907844 3:63826367-63826389 CAGTGGGAATGGGGAGATAAAGG + Intronic
956299249 3:67751869-67751891 TGGGGGGAAGGGTGAGAAGTGGG + Intergenic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
958646595 3:96882498-96882520 TGGTGGGAGTGGTGAGAGGTGGG - Intronic
959254088 3:103989061-103989083 CAGTGGGATGGGTGAGGAGCTGG + Intergenic
960253067 3:115478571-115478593 CAGCTGGATTGGTCAGAAGTTGG + Intergenic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
960296623 3:115952562-115952584 CAGGGGGAATGGTGAGAGGAGGG + Intronic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
961953687 3:130777301-130777323 AAGTGGGAATAGGGAGATGTTGG + Intergenic
961977422 3:131041913-131041935 CATTGGGACTGGTTAGATGTGGG + Intronic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962350478 3:134652152-134652174 CAGTGATAAGGGTGAGAAGGTGG - Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963087446 3:141451271-141451293 TAGTGGGGATGGTAAGAAATGGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963975218 3:151472887-151472909 CAGTGTGGGTGGTGAGAACTTGG - Intergenic
964155690 3:153582440-153582462 GAAGGGGAATGGTGTGAAGTGGG - Intergenic
964282309 3:155079979-155080001 CAGTGGGATTCGGGAGAAGTTGG - Intronic
964683543 3:159368711-159368733 TAGTGGGCATGGTGAGAGATAGG + Intronic
965035147 3:163428374-163428396 CAGTGGGAATGATGAAGGGTAGG + Intergenic
965382509 3:168007313-168007335 TAGTGAGTATGGAGAGAAGTGGG + Intergenic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967180182 3:186896664-186896686 AAGTGGCAATGGTGAGAAATGGG - Intergenic
967442335 3:189523295-189523317 GAATGAGAATGGTGAAAAGTAGG - Intergenic
967479072 3:189953682-189953704 CAGTGGTATGGCTGAGAAGTGGG - Intergenic
968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG + Intronic
969390834 4:6890281-6890303 CAGTGGGAATGGAGACAGCTTGG + Intergenic
971033771 4:22670141-22670163 AGCTGGGAATGGTGAGTAGTGGG + Intergenic
971150481 4:24026218-24026240 AACTGGGACTGGTGGGAAGTGGG - Intergenic
971225511 4:24748028-24748050 CAGTGGGAAGGGTCATAAGAAGG + Intergenic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
975060093 4:69986189-69986211 CAGTGGGATGGGTGAGGAGCTGG + Intergenic
975647271 4:76557464-76557486 CAGGGGAAATGGGGAGATGTTGG + Intronic
975670465 4:76775102-76775124 CAGCGGGAAGGGTGGGAGGTGGG - Intronic
976122418 4:81797877-81797899 GAGGGGGAATGGGGAGATGTTGG + Intronic
976666017 4:87593100-87593122 CACTGGGAAGGGTGGGATGTAGG + Intergenic
976903607 4:90208834-90208856 CAGTGGGACTGGTTAGAAACTGG - Intronic
978119326 4:105059592-105059614 GGGTGGGAATGGGGAGAAGAGGG + Intergenic
978199394 4:106007652-106007674 CAGAGGGAATGGTGGGAGGGAGG - Intergenic
978247705 4:106595035-106595057 CAATGGAAGTGATGAGAAGTGGG - Intergenic
978443592 4:108759710-108759732 TAGTGGGAATGGGGAGGGGTGGG + Intronic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980115964 4:128679186-128679208 CAGTGGGCATGGTGGAAGGTGGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980874331 4:138645760-138645782 CTGTGGAAAAGGTGAGAAGCAGG + Intergenic
981535596 4:145796349-145796371 CACTGGGAAGGGTGAGAGTTTGG + Intronic
981538501 4:145824645-145824667 CAGAGGCACTGGTGAGAGGTAGG - Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
982358877 4:154497317-154497339 TGGAGGGAATGGGGAGAAGTTGG - Intergenic
982362103 4:154530061-154530083 GCGAAGGAATGGTGAGAAGTTGG - Intergenic
982697757 4:158622710-158622732 CAGGGGGAATGAGGAGATGTAGG + Intronic
982803992 4:159740334-159740356 CAGGGGAAAGGGTGGGAAGTGGG - Intergenic
983215741 4:165000819-165000841 CCTTGGGAATGGGGAGAAGAAGG + Intergenic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984579024 4:181488305-181488327 CAGTACAATTGGTGAGAAGTCGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985715723 5:1459882-1459904 TAGTGGGGATGCTGAGAAGTGGG - Intronic
986019019 5:3783692-3783714 CAGTGGGTCTGCTGAGAAGCAGG + Intergenic
986184794 5:5425158-5425180 CAGTGGAGATGTTGAAAAGTGGG - Intronic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986346339 5:6838818-6838840 CAGTGGAGATGCTGAGAAGCAGG + Intergenic
986612137 5:9579707-9579729 CAGGGGAAAGGGTGAGAAGTGGG + Intergenic
987924163 5:24318285-24318307 CACTGGGAATGGTTAGAAAGTGG - Intergenic
988249185 5:28732894-28732916 GAGTGGGGATGGGGAGATGTTGG - Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
989993134 5:50792779-50792801 CAGTGGAAGTGGTGAGAAAAGGG - Intronic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991367880 5:65887747-65887769 CATTGGGAATGATAATAAGTAGG + Intergenic
991443714 5:66678265-66678287 TGGGGGGAATGGGGAGAAGTTGG + Intronic
991481926 5:67090298-67090320 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991481938 5:67090330-67090352 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
993948413 5:94143155-94143177 AAGAGGGAATGAAGAGAAGTTGG - Intergenic
994728356 5:103462844-103462866 CAGTGTGAATGCTGTGAGGTGGG - Intergenic
995441775 5:112200162-112200184 CATTGGGAATGGAAAGAAGCAGG - Intronic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
997991125 5:138544993-138545015 AGGTGGGAAAGGTGAGGAGTAGG + Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998562070 5:143181062-143181084 CAGTGGGGATGGTGACTGGTAGG - Intronic
998787557 5:145729117-145729139 CAGTGGGAAAGCTGAGTACTCGG - Intronic
998787608 5:145729613-145729635 CAGTGGGAAAGCTGAGTACTCGG - Intronic
998871965 5:146561495-146561517 CAGTGGGAATGATGAAACGCAGG + Intergenic
998925359 5:147117848-147117870 CAGTGAGAATGCAGAGAAATGGG - Intergenic
998937099 5:147240906-147240928 CAGTGAGAAAGGTGGAAAGTAGG + Intronic
999041804 5:148421999-148422021 CAATGGGAAAGGAGAGATGTAGG - Intronic
999237539 5:150108049-150108071 AAGTGAGAAGGGTGAGGAGTTGG + Intronic
999845517 5:155475307-155475329 CTGTGGGAAGGGTGTGGAGTTGG - Intergenic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000790205 5:165597381-165597403 CAGTCGGGATGTTGAGAAATGGG - Intergenic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1001245105 5:170100355-170100377 CAGTGGGAATAGTGAGAGCTGGG - Intergenic
1001727760 5:173921423-173921445 CAGAGGAAATGGTGAGGAGGAGG + Intronic
1002214497 5:177620359-177620381 CAGGGGGAAGGGTGGGAAGTGGG + Intergenic
1002816708 6:687781-687803 CACTGGGATGGGTGAGAAGTTGG + Intronic
1003366161 6:5476795-5476817 GAGTGGAAATGGGGAGAGGTGGG + Intronic
1003919860 6:10823003-10823025 GAGGGGGAATGGTTAGAAGTTGG - Intronic
1004271725 6:14201692-14201714 CAGTGAGAAAGGTGAGAACTAGG + Intergenic
1004313452 6:14565806-14565828 CATTGGGAATGATGGTAAGTGGG - Intergenic
1004735214 6:18399219-18399241 GGGTGGGAATGGGGAGATGTTGG - Intronic
1006376929 6:33676881-33676903 CAGTGGCAAGGGTGAGGAGGTGG + Exonic
1006477218 6:34264328-34264350 TAGGGGGAATGGAGAGATGTTGG - Intergenic
1006625500 6:35394884-35394906 CAGTGGCAATGCTGAGATGAGGG - Intronic
1006938880 6:37738203-37738225 CAGTGGGGAGGGTGAGAAGGGGG + Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007995756 6:46306115-46306137 CAGGGGATATGGTGAGGAGTAGG + Intronic
1008436911 6:51486416-51486438 CACTGGGAATGGTCAGAAAGTGG - Intergenic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1008595729 6:53039876-53039898 CAGTGGGAATATACAGAAGTAGG + Intronic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1009912052 6:69942506-69942528 GAGTGGGGATAGGGAGAAGTTGG - Intronic
1009962618 6:70542035-70542057 AAGTGAGAATGGGGAGAAGGGGG - Intronic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1010588232 6:77680849-77680871 GAGTGAGACTGATGAGAAGTAGG + Intergenic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1014020552 6:116583364-116583386 TAGTAGGAATGGTGAGATGCTGG + Intronic
1015062664 6:128985703-128985725 CAGTGGGAAAGGAGAACAGTTGG - Intronic
1015337383 6:132055729-132055751 CAGTGAGTATGTTGAGAAATGGG + Intergenic
1015495984 6:133883872-133883894 CAGAGGAAATGGTGAGAAGAGGG + Intergenic
1016099636 6:140082744-140082766 CAATGGAAATGGTGAGAAGAAGG + Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1017043464 6:150325920-150325942 CAGGGGAGGTGGTGAGAAGTGGG + Intergenic
1017557804 6:155591274-155591296 AGGTGGGAATGAAGAGAAGTTGG - Intergenic
1018353599 6:162989096-162989118 CAGTGAGAATGTAGAGAAGGGGG + Intronic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1019125963 6:169840240-169840262 GAGTGGGAGTGGTGTGGAGTGGG - Intergenic
1019125977 6:169840300-169840322 GAGTGGGCATGGTGTGGAGTGGG - Intergenic
1019125981 6:169840316-169840338 GAGTGGGCATGGTGTGGAGTGGG - Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020446672 7:8276139-8276161 CACTGGGAAGGGTGAGAGGGTGG - Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1022107346 7:27205956-27205978 GAGAGGGAATGGTGAGGGGTCGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022845846 7:34209124-34209146 TAGTGGGTATGATGAGAAGGAGG + Intergenic
1022977919 7:35575554-35575576 CAGTGGAAATTGTGAGGATTTGG + Intergenic
1023757199 7:43431001-43431023 CAGGAGGAATGCTCAGAAGTTGG - Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024317193 7:48032111-48032133 GAGTGGGAATGGGGAGATGTTGG + Intergenic
1026028366 7:66766681-66766703 CAGTGGGAATGGAAAGACGACGG - Intronic
1026215284 7:68342966-68342988 CAATGGGAGTGATGAGAAGTGGG + Intergenic
1026331695 7:69357575-69357597 CAGGCAGAATGGTGACAAGTTGG - Intergenic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1028469259 7:91186484-91186506 CAATGATAATGGGGAGAAGTTGG - Intronic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028831106 7:95327422-95327444 CAGTGGAAATGGGGAAAATTGGG - Intergenic
1029393182 7:100288820-100288842 CAGTGGGTATGGGGAGCCGTGGG + Intergenic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1030054588 7:105572194-105572216 CAGGGGGATTGGGGAGATGTTGG - Intronic
1030113817 7:106048458-106048480 CAGGGTGAATGGCCAGAAGTGGG - Intergenic
1030291952 7:107881445-107881467 TGGGGGGAATGGTGAGATGTTGG - Intergenic
1030334396 7:108308766-108308788 TGGTGGGAGTGGTGAGAAGGGGG + Intronic
1030482218 7:110119517-110119539 CAGTGGGACTGGTTAGACGGTGG + Intergenic
1031026191 7:116682775-116682797 CAGTGGGCATGGCGAAAAATTGG - Intronic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1035299480 7:157887725-157887747 GAGTGGGTATGGTGGGGAGTGGG - Intronic
1035386869 7:158478865-158478887 CAGTGGGAATGGGGCAAAGATGG + Intronic
1035725223 8:1820422-1820444 AAGTGGGATTGCTGAGAAATGGG + Intergenic
1036095046 8:5714545-5714567 GAGTGGGACTGGGGAGGAGTAGG - Intergenic
1036285893 8:7443889-7443911 CAGTGGGTATTGGGAGAAGCCGG - Intronic
1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG + Intronic
1037740937 8:21608804-21608826 CACTGGGAATGGTGCTAAGAAGG - Intergenic
1037838560 8:22228642-22228664 CAGTGGGAATGCTGCAAAGCCGG + Intronic
1038400431 8:27280303-27280325 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1038875390 8:31542955-31542977 CACTGTGAGTGGTGATAAGTGGG + Intergenic
1039158719 8:34592956-34592978 GAGTGGCAATGGAGAGATGTTGG + Intergenic
1039169880 8:34731765-34731787 CAGTGGTAATGGTGTGATCTTGG - Intergenic
1039254541 8:35704769-35704791 CAGGGGGAATGGGGAGAACAGGG + Intronic
1040946304 8:52888278-52888300 AAGTGTAAATAGTGAGAAGTGGG + Intergenic
1041838421 8:62242566-62242588 CATTGGGACTGGTTAGACGTAGG - Intergenic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1043881597 8:85549635-85549657 GGGTAGGCATGGTGAGAAGTGGG + Intergenic
1044177255 8:89142716-89142738 CAGAGGGCATGGGGAGAGGTAGG - Intergenic
1044770595 8:95627174-95627196 TAGTGTGAAAGGTCAGAAGTAGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045530668 8:102982150-102982172 TAGTGTAAGTGGTGAGAAGTTGG + Intergenic
1045696016 8:104809660-104809682 TAGTGGGGATGGTAAGAAGATGG - Intronic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046272010 8:111909114-111909136 CAGAGGCAATGGTGGGAATTGGG - Intergenic
1046323526 8:112610018-112610040 TAGGGGAAATGGTGAGATGTCGG + Intronic
1046790761 8:118319333-118319355 CAGGGTGAAGGGAGAGAAGTGGG - Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047219030 8:122903808-122903830 AAATGGGAATGGTTAGAAATGGG + Intronic
1047406091 8:124586852-124586874 CAGTGGGAATGGGAAGGAGGGGG + Intronic
1047805319 8:128353396-128353418 CACTTGGAAAGGTGACAAGTGGG - Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048292685 8:133192560-133192582 AAGTAGGAATGGTTAGAAATTGG - Intronic
1048440869 8:134458240-134458262 CAGGAGGAATGGGGAGAATTAGG + Intergenic
1048635383 8:136289863-136289885 CACAGGGAATGGGGAGATGTTGG - Intergenic
1049640273 8:143712165-143712187 CAGAGGGAGTGCAGAGAAGTGGG - Intronic
1050008261 9:1157767-1157789 AAGTAGGAGTGGTGAGAACTGGG + Intergenic
1050123930 9:2337009-2337031 AGGTGAGAGTGGTGAGAAGTAGG - Intergenic
1050604206 9:7283710-7283732 CATTGGGACTGGTCAGAATTGGG - Intergenic
1050614423 9:7387434-7387456 CAGTGGGTATGGTGTGAGATAGG - Intergenic
1051201641 9:14633355-14633377 CAGTGGGAATGTTGGGCAGTAGG - Intronic
1051733678 9:20175229-20175251 CAGGGGGAAAGGTGGGAAGGCGG + Intergenic
1052685635 9:31752091-31752113 CATGGAGAATGGTGAGCAGTAGG - Intergenic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1053040584 9:34867395-34867417 CAGAGGTAATGGAGAGAGGTGGG + Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055062045 9:72079046-72079068 CAGTGGGAAGGGTGGGAGGGAGG + Intergenic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1056139128 9:83657480-83657502 CAGTGGAGGTGGTAAGAAGTTGG - Intergenic
1056372551 9:85971855-85971877 CAGTGGGGAGAGTAAGAAGTTGG - Intronic
1056857391 9:90144470-90144492 GAGTGGTAATGGGGAGATGTAGG - Intergenic
1056897012 9:90560322-90560344 CAGGGGAAAGGGTGGGAAGTGGG + Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057575770 9:96241148-96241170 CAGTGTGAATGGGAAGAACTCGG + Intronic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1057919327 9:99083760-99083782 CAGTGGATGTGGTGAGAAGTGGG + Intergenic
1058032686 9:100216850-100216872 GAGTCTGAATGGTGAGAGGTGGG - Intronic
1058285001 9:103166664-103166686 CAGTGAGGATGTGGAGAAGTGGG - Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1058506828 9:105674865-105674887 CAGAGGGAACGGTAAGAAGCAGG - Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1059009146 9:110437784-110437806 TTGAGGGAAGGGTGAGAAGTGGG - Intronic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1060601715 9:124882463-124882485 CAGGGGGAGTGCTGGGAAGTGGG + Intronic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061617930 9:131792389-131792411 CAGTGGCATTCGTGGGAAGTGGG - Intergenic
1061633137 9:131886420-131886442 CAGTGGGGGTAGGGAGAAGTGGG - Intronic
1185833833 X:3327112-3327134 CAATGGGAACGGGCAGAAGTAGG - Intronic
1186007060 X:5084453-5084475 CAGAGCAAAGGGTGAGAAGTAGG - Intergenic
1186307385 X:8277049-8277071 CACTGGGAAGAGAGAGAAGTGGG + Intergenic
1186313946 X:8348940-8348962 CATAGGGAAGGGTGAGAAGTTGG - Intergenic
1186682360 X:11889207-11889229 TAGTGGGGAATGTGAGAAGTTGG - Intergenic
1187407834 X:19020080-19020102 CAGAGGGATTGGGGAGATGTTGG + Intronic
1187929515 X:24281067-24281089 CCGTGGGGGTGGTGAGAAGCGGG + Intergenic
1187974362 X:24690607-24690629 CTCTGGGAAAGGTGAGAAGGAGG - Intergenic
1188250440 X:27887115-27887137 AAGTGGGGAAGGTGAGAAGGAGG - Intergenic
1188465058 X:30470367-30470389 CAGTAGAAATGGTGAGTAGTGGG - Intergenic
1189853543 X:45200443-45200465 GAGTGGTAATGGTCTGAAGTTGG - Intronic
1190262326 X:48805267-48805289 CAGTGGCAGTGGTGAGGAGAGGG + Intronic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1190449446 X:50563799-50563821 CAGTGGGATTTGTGAGATTTTGG - Intergenic
1190472439 X:50796428-50796450 GAGTGGAAATGGTGGGAGGTGGG + Intronic
1190842026 X:54154185-54154207 CAGTGCAAATGTTAAGAAGTAGG + Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191820928 X:65306996-65307018 AAGTGGGTATGGTGAGAGGCTGG + Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192491419 X:71579543-71579565 CAGTGGCTGTGGGGAGAAGTGGG + Intronic
1192938825 X:75891639-75891661 CAGGGGGAATGAAGAGATGTTGG + Intergenic
1193197388 X:78649231-78649253 CAGGGGGAAGGGTGAGAGGGTGG + Intergenic
1193264245 X:79449631-79449653 CAGTGTCACAGGTGAGAAGTAGG - Intergenic
1194358036 X:92912425-92912447 AAGGGGAAATGGTGAGATGTTGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195576862 X:106461161-106461183 TTGTGGTAATAGTGAGAAGTGGG + Intergenic
1195762203 X:108258615-108258637 CAGTGGGAATGTTCAGCAGCAGG + Intronic
1196871317 X:120116003-120116025 GAGAGGGAATGGAGAGGAGTGGG + Intergenic
1197087053 X:122491107-122491129 CAGGGAGAAGGGTGGGAAGTGGG - Intergenic
1197296843 X:124729588-124729610 CATTGGGAATTTTGAGAAGAAGG + Intronic
1198662362 X:138983535-138983557 TAGTGAGAATGCTGAGAAATTGG + Intronic
1199202663 X:145111024-145111046 AACTGGGAAGTGTGAGAAGTCGG - Intergenic
1199627920 X:149757875-149757897 CAGAGGGATGGGTAAGAAGTGGG - Intergenic
1199870069 X:151890471-151890493 CAGTTGGCATGGTAAGAAGTGGG + Intergenic
1199878651 X:151955202-151955224 CTGATGTAATGGTGAGAAGTTGG - Intronic
1199916205 X:152343596-152343618 CTGTGTGAATGGAGAGAATTTGG - Intronic
1200666217 Y:6028076-6028098 AAGGGGAAATGGTGAGATGTTGG + Intergenic
1201795203 Y:17889669-17889691 CACTGGGAGTGCTGGGAAGTGGG + Intergenic
1201806352 Y:18016315-18016337 CACTGGGAGTGCTGGGAAGTGGG - Intergenic