ID: 909316338

View in Genome Browser
Species Human (GRCh38)
Location 1:74223981-74224003
Sequence CTCTATAATCAGCAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909316338_909316349 27 Left 909316338 1:74223981-74224003 CCCTCCTCCTGCTGATTATAGAG No data
Right 909316349 1:74224031-74224053 TAGCCAGGTAGAGGTTATAGTGG 0: 1
1: 7
2: 52
3: 108
4: 248
909316338_909316344 1 Left 909316338 1:74223981-74224003 CCCTCCTCCTGCTGATTATAGAG No data
Right 909316344 1:74224005-74224027 CCAGAGCCTTGAGTGAACATAGG 0: 7
1: 47
2: 167
3: 335
4: 633
909316338_909316345 4 Left 909316338 1:74223981-74224003 CCCTCCTCCTGCTGATTATAGAG No data
Right 909316345 1:74224008-74224030 GAGCCTTGAGTGAACATAGGCGG No data
909316338_909316347 12 Left 909316338 1:74223981-74224003 CCCTCCTCCTGCTGATTATAGAG No data
Right 909316347 1:74224016-74224038 AGTGAACATAGGCGGTAGCCAGG 0: 3
1: 105
2: 291
3: 545
4: 797
909316338_909316348 18 Left 909316338 1:74223981-74224003 CCCTCCTCCTGCTGATTATAGAG No data
Right 909316348 1:74224022-74224044 CATAGGCGGTAGCCAGGTAGAGG 0: 3
1: 55
2: 239
3: 385
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909316338 Original CRISPR CTCTATAATCAGCAGGAGGA GGG (reversed) Intronic
No off target data available for this crispr