ID: 909316393

View in Genome Browser
Species Human (GRCh38)
Location 1:74224430-74224452
Sequence GTTTGTGGATATTCATCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909316393_909316398 -7 Left 909316393 1:74224430-74224452 CCCAAAGATGAATATCCACAAAC No data
Right 909316398 1:74224446-74224468 CACAAACATCAAGGCTTTTCGGG 0: 1
1: 0
2: 3
3: 19
4: 213
909316393_909316397 -8 Left 909316393 1:74224430-74224452 CCCAAAGATGAATATCCACAAAC No data
Right 909316397 1:74224445-74224467 CCACAAACATCAAGGCTTTTCGG 0: 1
1: 0
2: 1
3: 17
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909316393 Original CRISPR GTTTGTGGATATTCATCTTT GGG (reversed) Intronic
No off target data available for this crispr