ID: 909324617

View in Genome Browser
Species Human (GRCh38)
Location 1:74334689-74334711
Sequence AGTTAAATGGAGAAGATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 13, 3: 35, 4: 467}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909324612_909324617 7 Left 909324612 1:74334659-74334681 CCCTCTCTGACCCTATGGATGTA 0: 1
1: 0
2: 1
3: 9
4: 118
Right 909324617 1:74334689-74334711 AGTTAAATGGAGAAGATGCCAGG 0: 1
1: 0
2: 13
3: 35
4: 467
909324615_909324617 -4 Left 909324615 1:74334670-74334692 CCTATGGATGTAGAGTCTCAGTT 0: 1
1: 0
2: 3
3: 8
4: 104
Right 909324617 1:74334689-74334711 AGTTAAATGGAGAAGATGCCAGG 0: 1
1: 0
2: 13
3: 35
4: 467
909324610_909324617 28 Left 909324610 1:74334638-74334660 CCACATGCTTCATTACTTTATCC 0: 1
1: 0
2: 1
3: 20
4: 220
Right 909324617 1:74334689-74334711 AGTTAAATGGAGAAGATGCCAGG 0: 1
1: 0
2: 13
3: 35
4: 467
909324613_909324617 6 Left 909324613 1:74334660-74334682 CCTCTCTGACCCTATGGATGTAG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 909324617 1:74334689-74334711 AGTTAAATGGAGAAGATGCCAGG 0: 1
1: 0
2: 13
3: 35
4: 467
909324614_909324617 -3 Left 909324614 1:74334669-74334691 CCCTATGGATGTAGAGTCTCAGT No data
Right 909324617 1:74334689-74334711 AGTTAAATGGAGAAGATGCCAGG 0: 1
1: 0
2: 13
3: 35
4: 467
909324609_909324617 29 Left 909324609 1:74334637-74334659 CCCACATGCTTCATTACTTTATC No data
Right 909324617 1:74334689-74334711 AGTTAAATGGAGAAGATGCCAGG 0: 1
1: 0
2: 13
3: 35
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909324617 Original CRISPR AGTTAAATGGAGAAGATGCC AGG Intronic
900132181 1:1091849-1091871 AGTTAAATGGAGATGGGGCAGGG + Intronic
900434958 1:2625576-2625598 AGTTAACTGCAGAAGATAGCAGG - Intronic
901554129 1:10018287-10018309 AGCCAAATGGAGGAGATGCATGG + Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902655492 1:17865211-17865233 ACTTAAGTGGAGAAGAGGCAAGG + Intergenic
903762865 1:25711497-25711519 AGATAAATGGACCAGATACCTGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905030734 1:34882820-34882842 AGTTAATTGGAGAACAGGCAGGG - Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905937064 1:41833185-41833207 AGTTCAAAGGAGCAAATGCCTGG + Intronic
906169328 1:43710380-43710402 AGTGAAAAGAAGCAGATGCCAGG - Intronic
907443322 1:54491407-54491429 AGGTAAATGGGGAAGACTCCAGG + Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
908084797 1:60619984-60620006 AGTTAAATGGGGAAGATGGGTGG - Intergenic
909324617 1:74334689-74334711 AGTTAAATGGAGAAGATGCCAGG + Intronic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912727665 1:112073671-112073693 AGTTAAAAGGAAAAGATGCCAGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916797644 1:168181505-168181527 AGTTATATGGAGAGGAGGCCGGG - Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918028283 1:180775782-180775804 TGTTAAATGGAGAAGAGTGCTGG + Intronic
918180762 1:182084647-182084669 TGAAAAATGGAGAAGATTCCAGG - Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
920191881 1:204199013-204199035 TGTCAAATGGAGAAGGTGCGGGG + Intronic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920860707 1:209704101-209704123 AGAAACATGGAGAAGATGCTAGG - Intronic
920879874 1:209869909-209869931 AGTAAAAGGGAGAAGATTCCTGG - Intergenic
921742944 1:218707267-218707289 AGTTCCATGGACAGGATGCCTGG - Intergenic
922517134 1:226215847-226215869 AGGGAAATGGAGAAGAAGCAAGG - Intergenic
922677837 1:227563680-227563702 AGTTACATAGCTAAGATGCCAGG + Exonic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063166008 10:3463005-3463027 AGGTAAATGGGGAAGATTGCAGG + Intergenic
1063646821 10:7893397-7893419 AGTTAAACAGAGAAGAAGCAGGG + Intronic
1063931307 10:11031044-11031066 AGTTAATGGGGGAAAATGCCAGG - Intronic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065758909 10:28963607-28963629 AGTTAGCAGGAGAAGAGGCCAGG + Intergenic
1066957621 10:42188051-42188073 AGTTAACTGGAGAAGATGACCGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068729918 10:60345894-60345916 ACTGATATGGGGAAGATGCCAGG + Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070094183 10:73320623-73320645 AGTTAAATGGGAAAGAAGGCTGG - Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073131352 10:101191026-101191048 AGTGAGGTGCAGAAGATGCCGGG - Intergenic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1076073497 10:127513067-127513089 ATTTATATGGAGAAGAACCCAGG - Intergenic
1076673329 10:132135048-132135070 AGTTGGATGAAAAAGATGCCCGG + Exonic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077572229 11:3349419-3349441 ATTTAAATTCAGAAGCTGCCAGG + Intronic
1078152738 11:8773179-8773201 CCTTAAATGGAGAATGTGCCTGG + Intronic
1078367464 11:10718623-10718645 AGCTGAATGGAGAAAATGCCTGG + Intergenic
1078624867 11:12945870-12945892 AAGTAAATGGTGAAGATGCTTGG - Intergenic
1079423837 11:20320920-20320942 TGTTAATTGGAGAAGATGCTAGG + Intergenic
1079990277 11:27239373-27239395 GGATAAATGGAGCAGCTGCCAGG - Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080883334 11:36342769-36342791 ATTTAAAGGGAGAAGAAGACTGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081514136 11:43808232-43808254 TGTTAAATGTTGAAGAAGCCTGG + Intronic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081865025 11:46354800-46354822 ACCTAAATGCAGAATATGCCTGG - Intronic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1084233113 11:67767731-67767753 AGAAAAATGGAGCAGAGGCCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1088904732 11:114146254-114146276 AATTAGATGGAGAAAATCCCAGG + Intronic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091219913 11:133924302-133924324 AGATAAATGGAGAAAATGCTAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092713462 12:11363252-11363274 AGCTAAGTGAACAAGATGCCTGG - Intronic
1092994066 12:13931499-13931521 AGTTAGATGGAAAAAATGTCAGG - Intronic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093399019 12:18720501-18720523 AGTTAAATGGATATGAGTCCAGG - Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093779759 12:23121730-23121752 AGTTACACGGAGAAGAGGACAGG + Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094476227 12:30842734-30842756 AGTCAGATGGAGATAATGCCTGG + Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097585750 12:61514183-61514205 AGATGAATGGAAAAAATGCCTGG - Intergenic
1098551951 12:71772317-71772339 AGTTAAAAGTAGAAGCTACCAGG + Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100630269 12:96381816-96381838 AATTAAAAAAAGAAGATGCCAGG + Intronic
1100644691 12:96516398-96516420 ACTCAAATGGAGAAGCTGCAGGG + Intronic
1100707319 12:97215694-97215716 AGCTAAATGCAGAGGAGGCCTGG - Intergenic
1100995477 12:100295898-100295920 AGCTCCATGGAGCAGATGCCGGG + Intronic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102472399 12:113166932-113166954 AGTTAAGAGCAGAGGATGCCGGG + Intronic
1102889598 12:116548048-116548070 AGTGAAAAGGAGAAGTTGACAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103164247 12:118756673-118756695 AGTTAATTGGAGAAGATGGATGG - Intergenic
1104594470 12:130111668-130111690 TGTAAAATGGAGAAGACACCAGG - Intergenic
1105626886 13:22121445-22121467 AGTTAAACTGACAAGCTGCCTGG + Intergenic
1107437344 13:40391705-40391727 AGATAAATGGAAAGGGTGCCTGG + Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108303118 13:49101087-49101109 AGTTAAAAGGAGAAGAAACAAGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109789794 13:67230933-67230955 CGTTAAACGGACAACATGCCCGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114256295 14:21004126-21004148 AGTTAACTGGATCATATGCCAGG + Intergenic
1114304632 14:21411239-21411261 AGTTGAATGGAGAATGGGCCGGG - Intronic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115848160 14:37560947-37560969 ACTGAAATGGAGAGTATGCCTGG - Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116433854 14:44875433-44875455 AGTTAAATGGAGAAGTAGTGAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1117819018 14:59629403-59629425 AATTACAAGGGGAAGATGCCAGG + Intronic
1117901324 14:60536590-60536612 ACTTAATTGGAGAAAAGGCCAGG + Intergenic
1118425206 14:65653020-65653042 AGATAGATGGAGAACAAGCCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1119555773 14:75551222-75551244 AGATAAATGCAGAGGATGGCAGG - Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120830261 14:88991684-88991706 GGTTCAATGGAGAAGAAGACAGG - Intergenic
1122318228 14:100838022-100838044 AGTGATGTGGAGAAGAGGCCCGG + Intergenic
1122911637 14:104831821-104831843 AATAAAATGGAGAACAAGCCAGG - Intergenic
1124533675 15:30526066-30526088 AGGGAGATGGAGAAGCTGCCAGG - Intergenic
1124764980 15:32481579-32481601 AGGGAGATGGAGAAGCTGCCAGG + Intergenic
1125399586 15:39286632-39286654 AGTTCACTGGAGGAGATGCAGGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1129218957 15:74120246-74120268 AGTTTGATGGATACGATGCCAGG + Intronic
1131300578 15:91196345-91196367 AGTTACATGGAAAAGGTGACAGG + Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1133601014 16:7340451-7340473 AGTGCAACGGAGAAGATACCAGG - Intronic
1133895312 16:9921705-9921727 AGTAAAATGGACAAGGTTCCTGG + Intronic
1134891732 16:17847028-17847050 AGTTGCATGGAGAAGATGACAGG - Intergenic
1135476689 16:22782677-22782699 AGTGAAATGTAAAAGATGGCAGG + Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136745860 16:32590189-32590211 AGTTAAAAGGTGAATATCCCCGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139907879 16:70379234-70379256 AGTTCATTGGAGAGGATTCCTGG - Exonic
1141348991 16:83275541-83275563 AGAGAGATGGAGAAGATGCAGGG + Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1203047988 16_KI270728v1_random:849394-849416 AGTTAAAAGGTGAATATCCCCGG + Intergenic
1143208988 17:5169244-5169266 TGTAAAATGGAGATAATGCCAGG + Intronic
1143353363 17:6306226-6306248 ATTTACATGGAGAAAAAGCCTGG + Intergenic
1144618478 17:16798719-16798741 TGTAAAATGGAGATAATGCCAGG + Intronic
1144799203 17:17913380-17913402 AGCTCCATGGAGCAGATGCCGGG + Intronic
1144894228 17:18516974-18516996 TGTAAAATGGAGATAATGCCAGG - Intergenic
1145138003 17:20427266-20427288 TGTAAAATGGAGATAATGCCAGG + Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1147020570 17:37529164-37529186 AGGTAAATGGAGAAAAGGGCTGG - Intronic
1148849587 17:50548201-50548223 AGTGAAATGGAGCAGGTGCTGGG + Intronic
1149871142 17:60182954-60182976 TGTAAAATGGAGATAATGCCAGG - Intronic
1150890847 17:69147672-69147694 AGAGAGAGGGAGAAGATGCCAGG + Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151584806 17:75002692-75002714 AGTTAAATGAAGAAGAGGTGTGG + Intronic
1152492696 17:80648411-80648433 AGGGACAAGGAGAAGATGCCTGG - Intronic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153367047 18:4268351-4268373 AGTTAAATAGAAAGTATGCCGGG + Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155047071 18:22112258-22112280 TGTAAAATGGAGATGAGGCCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156311149 18:35923240-35923262 AGTAAATAGGAGAAGAAGCCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157541772 18:48515774-48515796 AGTCCAAAGGAGAAGGTGCCAGG - Intergenic
1157753154 18:50195548-50195570 AGTTTGAAGGAGAAGATCCCTGG - Intergenic
1159205433 18:65244574-65244596 AATAAAATGGAGAAGCTGCCTGG + Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159647052 18:70931223-70931245 TATCAAATGGAGAAGATGCCTGG - Intergenic
1161424205 19:4193540-4193562 ATGTAAATGGAGATGATGGCAGG + Intronic
1161486208 19:4537166-4537188 AGTTGATTTGAGAAGATGCTAGG + Exonic
1162370943 19:10278946-10278968 TGTGAAATGGAGCAGATGGCTGG + Intronic
1164717233 19:30401715-30401737 AGGTAACTGGAGAAGATGAAAGG + Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
1168677177 19:58286997-58287019 AATGAAATGGAGAAGATGAAGGG - Intronic
925770424 2:7277014-7277036 AATTAAAGGGAGAATATACCAGG + Intergenic
926485246 2:13446729-13446751 ATTTAAAAGGAGAAGATGTGAGG + Intergenic
929559821 2:42949308-42949330 GGCTGAATGGAGAAGTTGCCAGG + Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931982019 2:67703768-67703790 AGGAAAATGAAAAAGATGCCTGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
934305739 2:91820565-91820587 AGTTAACTGGAGAAGATGACCGG - Intergenic
934327517 2:92032177-92032199 AGTTAACTGGAGAAGATGACCGG + Intergenic
934465906 2:94262756-94262778 AGTTAACTGGAGAAGATGACCGG + Intergenic
935148528 2:100413188-100413210 AGTTAATTACAGAAAATGCCAGG - Intronic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935620373 2:105125067-105125089 AGTCAAATAGAAAAGATTCCTGG - Intergenic
935740342 2:106141743-106141765 AAATAAATGGAAAAGATGGCCGG - Intronic
936249174 2:110854287-110854309 AGGTACAGGCAGAAGATGCCTGG - Intronic
936477392 2:112851246-112851268 AAGAAAATGGAGAAGGTGCCAGG + Intergenic
938603701 2:132870160-132870182 GGTTACCTGGAGAAAATGCCAGG - Intronic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939858544 2:147390572-147390594 AGTTTTGTGGAGAAGATTCCAGG - Intergenic
940500024 2:154482214-154482236 ACTGAAATGCAGAAGATGGCTGG + Intergenic
940818725 2:158327491-158327513 AGTTAAAGGGAAAAGAAGCAAGG - Intronic
940970524 2:159891909-159891931 AGTTAAATGAAGTTGATACCTGG + Intronic
941241796 2:163047825-163047847 AGTCAAATGAAGTAGGTGCCAGG + Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944263347 2:197697555-197697577 AGCTCCATGGAGCAGATGCCGGG + Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
945773021 2:214068867-214068889 AGTTTAATGGATAAGGTGTCAGG - Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947113817 2:226747982-226748004 AATAAAATGGAGAAAATACCTGG + Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948295177 2:236855334-236855356 AGCTGCCTGGAGAAGATGCCTGG - Intergenic
1168811775 20:709557-709579 AGATAAAAGGAGACGACGCCAGG + Intergenic
1168939365 20:1695583-1695605 GGTTAAAAGGAGAAAATGCCAGG + Intergenic
1169071934 20:2738133-2738155 GGTGAATTGTAGAAGATGCCAGG + Intronic
1169134858 20:3191023-3191045 AGTTACAAGGAGGACATGCCAGG - Intronic
1172409524 20:34710969-34710991 AGTTAGAGGGAGAAGATGGAGGG + Exonic
1175544002 20:59766375-59766397 AGTTAAATGGAAAGGAATCCAGG + Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177698503 21:24605346-24605368 ATTCAAATGGAGAAAATGACAGG - Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178421730 21:32448611-32448633 AGAAAAATGGAGAAGAGGCCAGG + Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180279825 22:10683393-10683415 AGTTAACTGGAGAACATGACCGG + Intergenic
1180587041 22:16901929-16901951 AGTTAACTGGAGAAGATGACCGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1183876524 22:40786853-40786875 AGTAAAATGGAGAAGACTCCAGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1184869082 22:47222163-47222185 CGTTAAAGAGAGAAGGTGCCAGG - Intergenic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949571495 3:5297839-5297861 AGGGAAATGGAGAAGATACTGGG + Intergenic
949735062 3:7162265-7162287 ACTTCAGTGGAGAAGATGCCTGG + Intronic
950036883 3:9892460-9892482 AGTTAAAAGTAGAAGAGGCTGGG - Intronic
950689395 3:14643654-14643676 AGGTAGATGCAGAAGCTGCCTGG - Intergenic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952175125 3:30853695-30853717 AGTAAAAGGGAGAAGACTCCTGG - Intronic
953854893 3:46493715-46493737 AGCTCCATGGAGCAGATGCCGGG - Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
956706211 3:72001315-72001337 AGGGAAATGGAGAAGATGCAGGG + Intergenic
957049559 3:75400918-75400940 AGAAAAATGGAGCAGAGGCCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
958799082 3:98735325-98735347 ATATAAATGGAGGATATGCCAGG - Intronic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960957579 3:123044860-123044882 AGTAACATGGAGAAGATGAAGGG - Intergenic
962429014 3:135302290-135302312 AGTCAAATGGAAGAGATGCATGG + Intergenic
963418684 3:145031155-145031177 AGTTAATTGGAGATGCTGGCAGG + Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965568159 3:170143342-170143364 AGTTAACTGTAGAGAATGCCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966458076 3:180141002-180141024 AGTTGAAAGGAGAAGATGGAGGG - Intergenic
968274559 3:197430047-197430069 CCTTCAAAGGAGAAGATGCCAGG - Intergenic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
969822028 4:9728056-9728078 AGAAAAATGGAGCAGAGGCCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973651827 4:53004471-53004493 AATTAAATGTAGTAAATGCCGGG - Intronic
973913629 4:55610165-55610187 AGTTAAATGAAAAAGAGGTCGGG + Intronic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975533616 4:75426123-75426145 AGTTCAATTGAGCAGAGGCCAGG - Intergenic
975857148 4:78636737-78636759 AATTAAATTTAAAAGATGCCGGG - Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977163250 4:93663054-93663076 AGATAAATGGAACAAATGCCAGG + Intronic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977764327 4:100778761-100778783 AGCTAAATTGGGAAGATGCTTGG - Intronic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978341593 4:107725579-107725601 AGTTATCTGGAGAATATGTCAGG + Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
979156542 4:117399143-117399165 AGTTCTATGGAAGAGATGCCTGG + Intergenic
979629427 4:122883163-122883185 AGTAAAATGGAGAAGAACCCAGG - Intronic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980324064 4:131318094-131318116 AATTAAAAAGAGAAGATTCCTGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981230370 4:142346936-142346958 ATTTAATAGGTGAAGATGCCAGG + Intronic
981655620 4:147109441-147109463 AGTGGAATGGTTAAGATGCCAGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983016256 4:162616784-162616806 ATTTAAATGTAGAAAATGTCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
985278715 4:188266217-188266239 ACTGAAATGGAGAAGACGACAGG - Intergenic
985519556 5:367120-367142 ACTAAAATGGAGAAGTTGCAGGG + Intronic
986674899 5:10175476-10175498 AGATAAATGGAGAAGGAGGCTGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987504385 5:18749824-18749846 AGTTAACTACAGAAGATGACAGG - Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
990720141 5:58685395-58685417 AGTTAAAGAGAGAAGATTCTGGG - Intronic
991301301 5:65131894-65131916 ATTTAAATAGAGAGGAGGCCAGG - Intergenic
991507213 5:67337857-67337879 AGTTAAATGAAGAAAATGTCAGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994150530 5:96442535-96442557 AGTTAAATGGACAGTATCCCTGG + Intergenic
994237957 5:97387275-97387297 AGTTACATGGAGGAGTTGCTGGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995025615 5:107418264-107418286 TGTTACATAGAGCAGATGCCAGG - Intronic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996494597 5:124139150-124139172 TGTACAATGGATAAGATGCCAGG + Intergenic
996746629 5:126851799-126851821 TGGGAAATGGAGAAGATTCCCGG + Intergenic
997648040 5:135494166-135494188 AGATAAATGGAGAATATCCCGGG + Intergenic
1000126176 5:158246048-158246070 AGTTAGAATGAGAAGAAGCCTGG - Intergenic
1000292240 5:159881246-159881268 AGGTAAATGTAGAAGATTACAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001576703 5:172769554-172769576 AGGTAAATGGAATGGATGCCTGG - Exonic
1002976756 6:2086467-2086489 ATTTAAGTGGAGATGCTGCCTGG - Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003015492 6:2464233-2464255 AGTTAAATGGTGAAAATGCTGGG + Intergenic
1003166137 6:3680075-3680097 AGCCATTTGGAGAAGATGCCGGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005783124 6:29214702-29214724 AGATAAAGGGAGAAGATCCAGGG + Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006695318 6:35926015-35926037 AGTTAAATGGCAAGGAAGCCTGG + Intergenic
1006996418 6:38265407-38265429 ATATCAATGGAGAATATGCCTGG + Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008199042 6:48563668-48563690 AGTGAGAGGGAGAAGATGCCAGG - Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010246185 6:73661842-73661864 AGCTCCATGGAGCAGATGCCGGG + Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011639281 6:89403951-89403973 ATTTAAATCAAGAAGTTGCCAGG - Intronic
1011843584 6:91532578-91532600 ATTTAAATGGAAAAAATGCGTGG - Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013164805 6:107580129-107580151 ATGTGAATGGAGCAGATGCCTGG + Intronic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014684420 6:124477886-124477908 AGATAATTGGAGAAAATGCTAGG - Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016269477 6:142272226-142272248 TGTTTAATGCAGAAGATTCCAGG + Intergenic
1017202771 6:151773699-151773721 AGTGAAAAAGAGAAGATGTCAGG - Intronic
1017543202 6:155424034-155424056 AAGGAACTGGAGAAGATGCCAGG - Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018715106 6:166526063-166526085 AGTTATGTGGAGAGGAGGCCTGG - Intronic
1018765342 6:166928608-166928630 ATTTAAAGAGAGAAGAGGCCAGG + Intronic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019070050 6:169338095-169338117 AGTTAACTGGATCATATGCCAGG - Intergenic
1019936064 7:4258749-4258771 AGTTGAATGGGGAAGACCCCCGG + Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021274146 7:18628254-18628276 AGGTAAAAGGAGATGAAGCCAGG - Intronic
1022004706 7:26256818-26256840 AATTAAATGCAAAAAATGCCTGG + Intergenic
1022846925 7:34219657-34219679 AGTTACATGGTTAAGAAGCCAGG - Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026415795 7:70179190-70179212 GGAGAAATGGAGAAAATGCCTGG + Intronic
1028086565 7:86644341-86644363 AATGAAAAGGAGAGGATGCCAGG + Exonic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030675662 7:112383322-112383344 AATCAAATGGAAAAGATGCAGGG + Intergenic
1030993948 7:116335401-116335423 AGTTAAACTGATGAGATGCCTGG + Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031540459 7:122988945-122988967 AATTAAATGGTCAAGATGTCAGG + Intergenic
1031793142 7:126135522-126135544 AATAAAATGGAAAAGAAGCCCGG + Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1034358125 7:150470172-150470194 AGCTAAATGGAGAGGATGCAGGG + Intronic
1035170451 7:157014607-157014629 TGTGAAATGGAGCAGTTGCCTGG + Intergenic
1036384154 8:8263322-8263344 AATTTAATGAAGAAGAAGCCTGG - Intergenic
1037362274 8:18085742-18085764 CTTTAAATGGAGAATGTGCCTGG + Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038055848 8:23856863-23856885 AGTTAGAAGTAGTAGATGCCAGG + Intergenic
1038987528 8:32828606-32828628 TGTTATATGGAGAAAATCCCTGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042651337 8:71045525-71045547 AGTAAAATGTCGAAGATACCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047963159 8:130025570-130025592 TGTTAGATGGGGAAGATTCCAGG + Intergenic
1050002116 9:1088244-1088266 AATCAAATAGAGAAGAGGCCAGG - Intergenic
1050348938 9:4721105-4721127 TTTAAAAAGGAGAAGATGCCAGG + Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1053601837 9:39618797-39618819 AGTCAACTGGAGGAGAAGCCGGG - Intergenic
1053695960 9:40639533-40639555 AGTTAACTGGAGAAGATGACCGG + Intergenic
1053859489 9:42372564-42372586 AGTCAACTGGAGGAGAAGCCGGG - Intergenic
1054251698 9:62723630-62723652 AGTCAACTGGAGGAGAAGCCGGG + Intergenic
1054307207 9:63438751-63438773 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054405940 9:64762743-64762765 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054439566 9:65248230-65248252 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054490841 9:65773709-65773731 AGTTAACTGGAGAAGATGACCGG - Intergenic
1054565811 9:66758147-66758169 AGTCAACTGGAGGAGAAGCCGGG + Intergenic
1055435316 9:76286847-76286869 TGTAAAATGGGGAAGATCCCAGG - Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056266489 9:84901766-84901788 ACATACATGGAGAAGAAGCCAGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057964640 9:99491290-99491312 AGGTAAAAGGAGAGGCTGCCTGG - Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1202778407 9_KI270717v1_random:13146-13168 AGTTAACTGGAGAAGATGACCGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186349078 X:8724990-8725012 AGTTAAATGGAAAAGTTGAAAGG + Intronic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190520898 X:51279105-51279127 AGCTCCATGGAGCAGATGCCGGG - Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192371172 X:70514299-70514321 AGTTAAAAGGAGAAAGGGCCGGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194175590 X:90643217-90643239 AATTAAATGGTGAAAATGCTTGG + Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194599652 X:95904465-95904487 AGTTAAAAAGAGAAGTTGCAAGG + Intergenic
1194615985 X:96103828-96103850 AATTAAGTGAAGAAGCTGCCAGG + Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197332024 X:125164915-125164937 AGTTGAATGGAGGTGATGGCTGG - Intergenic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1197713179 X:129686866-129686888 ATTTAAATGGAAAAGAAGCTTGG - Intergenic
1198244188 X:134813630-134813652 AATAAAAAGGAAAAGATGCCGGG + Intronic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199733933 X:150666773-150666795 ACTGAAATGGGGAAGATGGCAGG - Intronic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG + Intergenic