ID: 909329651

View in Genome Browser
Species Human (GRCh38)
Location 1:74396167-74396189
Sequence CAGGGAGATCAGAGGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 1, 1: 1, 2: 8, 3: 73, 4: 574}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909329643_909329651 8 Left 909329643 1:74396136-74396158 CCCCATCTCAAACATCTCACAAA No data
Right 909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG 0: 1
1: 1
2: 8
3: 73
4: 574
909329642_909329651 21 Left 909329642 1:74396123-74396145 CCTAACATGCTTGCCCCATCTCA 0: 1
1: 0
2: 2
3: 16
4: 157
Right 909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG 0: 1
1: 1
2: 8
3: 73
4: 574
909329644_909329651 7 Left 909329644 1:74396137-74396159 CCCATCTCAAACATCTCACAAAG 0: 1
1: 0
2: 2
3: 13
4: 231
Right 909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG 0: 1
1: 1
2: 8
3: 73
4: 574
909329641_909329651 22 Left 909329641 1:74396122-74396144 CCCTAACATGCTTGCCCCATCTC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG 0: 1
1: 1
2: 8
3: 73
4: 574
909329640_909329651 23 Left 909329640 1:74396121-74396143 CCCCTAACATGCTTGCCCCATCT No data
Right 909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG 0: 1
1: 1
2: 8
3: 73
4: 574
909329645_909329651 6 Left 909329645 1:74396138-74396160 CCATCTCAAACATCTCACAAAGT No data
Right 909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG 0: 1
1: 1
2: 8
3: 73
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909329651 Original CRISPR CAGGGAGATCAGAGGGCAGC AGG Intronic
900197118 1:1382058-1382080 CAGGGAGATGAGAGACCTGCAGG + Intergenic
900880344 1:5377049-5377071 CAGTGAGACCCGAGGGCAGCTGG - Intergenic
900938068 1:5779673-5779695 CAGGGAGACCTGAGGGTACCAGG + Intergenic
901037320 1:6344098-6344120 CAGGGAGAGGAAAGAGCAGCAGG + Intronic
901151603 1:7107011-7107033 CAGGGATGTCAGATGGCAGGTGG + Intronic
903238105 1:21963821-21963843 CCCAGAGATCAGAGGGGAGCTGG - Intergenic
904921741 1:34013501-34013523 CAGGGAGATAAGTAGGGAGCTGG + Intronic
906060331 1:42944238-42944260 CAGGAAGGGCAGAGGCCAGCAGG + Intronic
906680830 1:47724680-47724702 CAGGCAGGTCAGAGGGCACCTGG - Intergenic
906858182 1:49330909-49330931 CATGGAGAACAGAGGAAAGCAGG + Intronic
907334471 1:53691296-53691318 GATGGGGATCAGTGGGCAGCAGG - Intronic
907342666 1:53747991-53748013 CAGGGAGACCAATGGGAAGCTGG - Intergenic
908802903 1:67898338-67898360 CAGGGAGATCTGGTGGCAGTGGG + Intergenic
909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG + Intronic
910758511 1:90714339-90714361 GAGAGAGACCAAAGGGCAGCTGG - Intronic
910992160 1:93067552-93067574 TATGGAGATCAGAGGGCACCAGG + Intergenic
912546034 1:110452564-110452586 CAGGCAGATCTGAGAGCGGCAGG + Intronic
914390271 1:147215001-147215023 CAGGATGATCAGAAGGCAGAAGG + Intronic
914989324 1:152484948-152484970 CAGGGAGATCAGGAGGCAACAGG - Intergenic
915294309 1:154909389-154909411 CAGAGAGCTCAGAGGGTTGCAGG + Intergenic
915444431 1:155966788-155966810 CAGGGAGGGCAGAGGGCTGGGGG - Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
916052873 1:161048463-161048485 GAGGGAGACCAGAGGGCTGGAGG - Exonic
916657835 1:166893116-166893138 GAAGGAGATCAGTGGGCAGGAGG - Intergenic
916723325 1:167501745-167501767 CAAGGAGACCAGAAGGCAGGAGG + Intronic
917489300 1:175484002-175484024 CAAGGAGCTCACAGTGCAGCGGG - Intronic
917702666 1:177596986-177597008 CTGGGAGTTGAGTGGGCAGCAGG + Intergenic
917972686 1:180219013-180219035 AAGGGAGGTCAGAGGTCAGGTGG - Intergenic
920071368 1:203305459-203305481 CAGGGAGGTAGGGGGGCAGCCGG - Intergenic
920092683 1:203465485-203465507 CAGGATGATCTGAGGGCACCAGG - Intergenic
920292048 1:204929982-204930004 CATGGGGATCAGAGGGCAGGAGG + Intronic
920393361 1:205625631-205625653 CTGTGAGATCAGAAGGCACCAGG - Intronic
920868762 1:209775574-209775596 GAGGGAGATCAGAGAGGAGAGGG - Intronic
922033575 1:221826927-221826949 CAGGGAGCCCAGTGGTCAGCTGG + Intergenic
922061874 1:222100647-222100669 CAAGGAGATCAGGTGGGAGCCGG - Intergenic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922465360 1:225842747-225842769 TAGGGAGCCCACAGGGCAGCAGG + Intronic
922767578 1:228163879-228163901 CAGGGTGATCAGACGTCACCAGG - Intergenic
922869586 1:228891331-228891353 AAGAGAGATCTCAGGGCAGCTGG + Intergenic
923238506 1:232058180-232058202 CAGAGAGGGCAGAGGGCAGGAGG - Intergenic
924740176 1:246790248-246790270 CAGGGAGGGGAGAGGGCTGCTGG + Intergenic
924788147 1:247219423-247219445 CAGGAAGATCAAGGGGCAGCAGG + Intergenic
924805026 1:247355101-247355123 CAGGAAGATCAAGGGGCAGCAGG + Intergenic
1063313420 10:4978304-4978326 TAGGGAGATGGGAGGGCACCAGG + Exonic
1063314532 10:4989413-4989435 TAGGGAGATGGGAGGGCACCAGG - Exonic
1063360538 10:5452504-5452526 CAGGGAGATCAGACGGCAGGAGG + Exonic
1064222485 10:13454033-13454055 CAAGGAGCCCAGAGAGCAGCAGG + Intronic
1064451308 10:15444641-15444663 CAGGGAGATCACAGAGCTGAAGG + Intergenic
1065804734 10:29384073-29384095 CAGGGTGATCAGAGAGCAGGAGG + Intergenic
1065928263 10:30455875-30455897 CAGTTAGATCAGGGAGCAGCAGG - Intronic
1066567036 10:36731545-36731567 CAGGGAGATAGGAAGGCTGCAGG - Intergenic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1068558257 10:58482263-58482285 GGGGGAGAACAGAGGGCAACAGG - Intergenic
1069562716 10:69442030-69442052 CAGGGAGAGCAGGGGACAGGAGG + Intergenic
1069578188 10:69545322-69545344 TGGGGAGATCAGAGGGGAGCAGG - Intergenic
1069685812 10:70317783-70317805 GAGGAAGTTCTGAGGGCAGCTGG + Intronic
1069690928 10:70351521-70351543 CATGCAGAAGAGAGGGCAGCAGG - Intronic
1069735103 10:70648895-70648917 GAGGGAAGTCAGAGGGCAGGTGG - Intergenic
1069890954 10:71652219-71652241 CAGGGAGATGAGAGAGGAGCAGG - Intronic
1070164371 10:73886869-73886891 CTGGTAGATCTGAGGGCATCTGG + Intergenic
1070360735 10:75686156-75686178 CAGGGAGGACAGAGGGCCACTGG + Intronic
1070803233 10:79255559-79255581 CAGAGAAATAAGAGGGGAGCGGG - Intronic
1071511156 10:86263359-86263381 CTGGGAAATGAGACGGCAGCGGG + Intronic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1072888608 10:99301674-99301696 CAGCTAGACCAGATGGCAGCAGG + Intergenic
1073038078 10:100578287-100578309 CAGGGAGCTCAGAGCCTAGCTGG + Intergenic
1073262817 10:102203463-102203485 CAGGGAGATCAAGGGGCAGCAGG - Intergenic
1073467017 10:103700175-103700197 CAGGGAGTTAAAAGGGCAGGTGG + Intronic
1073514797 10:104066672-104066694 CAGGGAGATCAGGGAGTAACAGG + Intronic
1074287945 10:112116011-112116033 CAGGGAAATAGGAGAGCAGCAGG - Intergenic
1074728565 10:116342815-116342837 CAGGAAGAACAGAGAGAAGCAGG - Intronic
1074977977 10:118596219-118596241 CAGCGCGCTCAGCGGGCAGCGGG + Intergenic
1075166341 10:120071306-120071328 GAGGGGGATCCGAGGGCATCCGG + Intergenic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1076727947 10:132422022-132422044 CTGAGAGATGAGAGGGCGGCGGG + Intergenic
1076870467 10:133190468-133190490 CAGGGGGAGGAGACGGCAGCCGG + Intronic
1076903593 10:133351610-133351632 CAGGGAGAAGAGAGCACAGCCGG + Intronic
1077302175 11:1852429-1852451 CACGGAGAGCAAGGGGCAGCGGG + Intergenic
1077425477 11:2473980-2474002 GAGGGAGGTAAGCGGGCAGCCGG + Intronic
1077853608 11:6099782-6099804 GTGGGAGATCAGAGGGCAGCAGG - Intergenic
1078019366 11:7642438-7642460 CAGGGAGATCAAAGGAAAGTGGG - Intronic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1079339176 11:19597982-19598004 CAGAGAGACCACGGGGCAGCTGG + Intronic
1080687080 11:34524728-34524750 CAGGGAGAGGAAAGGGCACCTGG - Intergenic
1080835278 11:35935026-35935048 CAGGGAGCTCCAGGGGCAGCTGG + Intergenic
1080875149 11:36268010-36268032 CTGGGATATCAGAGGGCATGGGG - Intergenic
1081206722 11:40284115-40284137 CAGGGAGATCAGTGGGCTTAGGG + Intronic
1081436037 11:43028336-43028358 ACAGGAGATCAGAGGCCAGCAGG + Intergenic
1081541388 11:44037035-44037057 TGGGGAGAGCTGAGGGCAGCTGG + Intergenic
1081623983 11:44635690-44635712 CAGGGAGATCAGAAGGCAGCAGG + Intergenic
1081773585 11:45664089-45664111 CAGGGACGTCAGAGGCAAGCAGG - Intronic
1082609745 11:55282454-55282476 CAGGGAGAGAAGAAGGCAGAGGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082656938 11:55868071-55868093 CAGGGAGAGAAGAAGGCAGAGGG + Intergenic
1082744966 11:56951208-56951230 CAGAAAGATCAAGGGGCAGCAGG + Intergenic
1083144511 11:60748621-60748643 CAAGGAGTTCAGAGGGCCCCAGG - Intergenic
1083384158 11:62295402-62295424 TGGGGAGGTCAGGGGGCAGCAGG - Intergenic
1083628015 11:64081904-64081926 CCGGGAGTCCAGAGGGCTGCAGG - Intronic
1084025011 11:66442586-66442608 CAGGAAGATCAAGGGGCAGCAGG - Intronic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1084088264 11:66864660-66864682 AAGGGCGAGGAGAGGGCAGCGGG + Intronic
1084462114 11:69301970-69301992 CAGTGAGGTCAGAGGGCTCCCGG - Intronic
1085315021 11:75539592-75539614 CTGGGAGATTGGAGGGCAGGGGG + Intergenic
1085447625 11:76611102-76611124 CATGGAGAGGAGAGGGCTGCAGG + Intergenic
1085520177 11:77133108-77133130 CACGGGGATGAGAGGGCACCTGG + Intronic
1085730239 11:78991688-78991710 CAGGGAGACCAGGTGGCACCTGG + Intronic
1085940105 11:81198164-81198186 CAAGAAGATCAAGGGGCAGCAGG + Intergenic
1087065777 11:94026694-94026716 GAGGGAGATCAGGTGGCATCGGG + Intronic
1088451808 11:109989278-109989300 CAGGGAGATAGGAGTGGAGCCGG + Intergenic
1088814110 11:113409983-113410005 CAGGGCCGTCAGAAGGCAGCAGG + Exonic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1088898024 11:114092523-114092545 GAGGGGGAGCAGAGGACAGCGGG - Intronic
1089356456 11:117857077-117857099 CAGGGACATGAGAGGGCAGGAGG + Intronic
1091191277 11:133697513-133697535 CAGGCAGAACAGAATGCAGCCGG + Intergenic
1091393973 12:142418-142440 CAGGGATTTCAGAGGGCAATGGG - Intronic
1091527912 12:1323965-1323987 CAGGGAGGTGGGAGGGCAGGGGG - Intronic
1091571635 12:1691496-1691518 GAAGGTGAGCAGAGGGCAGCAGG - Intronic
1091891116 12:4055368-4055390 AAGGGAGAGCAGGGGGAAGCTGG - Intergenic
1092013734 12:5139164-5139186 CAGGCAGAGAACAGGGCAGCAGG + Intergenic
1092507364 12:9117341-9117363 CAGGAAGACCAGATGGGAGCTGG + Intergenic
1092538942 12:9407694-9407716 CAGAGAGAAAAGATGGCAGCTGG + Intergenic
1092556797 12:9568794-9568816 GAGGGAGAAAAGATGGCAGCTGG - Intergenic
1095063696 12:37738231-37738253 AAGGGAACTCAGAGGCCAGCGGG - Intergenic
1095601780 12:44021691-44021713 TAGAGGGATCAAAGGGCAGCAGG - Intronic
1095825321 12:46524899-46524921 CAGGGAGGTCAGAGAAAAGCAGG + Intergenic
1096078622 12:48819420-48819442 CAGGGAGCTGAGAGGACATCAGG + Intronic
1096086937 12:48871671-48871693 CAGGGAGATAAGAAAGAAGCCGG + Intergenic
1096560541 12:52433117-52433139 CAGTGAGCTCCGACGGCAGCTGG - Exonic
1096593880 12:52681708-52681730 CAGAGAGCTCTGAGGGCAGAAGG + Intergenic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1100140421 12:91612032-91612054 CTGGAAGATCAGAGGACAGAAGG - Intergenic
1100199098 12:92279337-92279359 CAGGAGGATCAGAGGGAATCAGG + Intergenic
1101309469 12:103563275-103563297 CAAGGGGATCAGAGGACATCTGG - Intergenic
1102182251 12:110921388-110921410 AAGGGAGATCGGAGCGCAGGAGG - Intergenic
1102452193 12:113050191-113050213 CAGGGAGGTCAGTGGGCTGGAGG - Intergenic
1102465999 12:113131175-113131197 CAGGGAGGCCTGAGGCCAGCAGG + Intronic
1102589374 12:113945944-113945966 CAGGGAGATCAGACCGCAGCTGG + Intronic
1103344772 12:120241866-120241888 AGGGGAGATCAGAGGGAGGCAGG + Intronic
1103749958 12:123151488-123151510 CAGGGAGGGCAGAGCGCAGCGGG + Intergenic
1104282546 12:127391148-127391170 CTGGGAAGTCAGAGAGCAGCAGG - Intergenic
1104602719 12:130163862-130163884 CAGGAAGACCAGCGTGCAGCCGG - Exonic
1105614335 13:21998712-21998734 CAGGGAGCTCAGAGGGTGGAGGG + Intergenic
1106754770 13:32811541-32811563 CAGGGAGCTCACAGAGGAGCAGG - Intergenic
1107373800 13:39780642-39780664 TAGGGAGGTCTGAGGGCATCTGG + Intronic
1107446718 13:40475888-40475910 CAGTGAGCTGGGAGGGCAGCAGG - Intergenic
1107817761 13:44259417-44259439 CAGGGAAATCAGTGGGCTACGGG + Intergenic
1108852905 13:54757285-54757307 CAATCAGATCAGAGGGCAGGAGG - Intergenic
1108944148 13:56000495-56000517 CAGGGAGATGAGGAGGCTGCAGG - Intergenic
1109194967 13:59368697-59368719 TGGGGAGATTAGAGGGGAGCAGG - Intergenic
1109798705 13:67347219-67347241 CAGGAAGATCAAGGGGCAGCAGG - Intergenic
1110324647 13:74200054-74200076 CAAGGAGATCACACGGCAGTGGG + Intergenic
1111096022 13:83516901-83516923 CTCGGAGAGCAGAGGGGAGCCGG - Intergenic
1111224272 13:85249036-85249058 CAGAGAGATCAGAGGAAAGGAGG + Intergenic
1112880846 13:104104716-104104738 CAGGGAAATCAGAGGGAAAGGGG - Intergenic
1113421514 13:110174730-110174752 CAGGGAGATCAAGGGATAGCGGG - Exonic
1113437178 13:110302219-110302241 CAGAAACATCAGAGGGCACCAGG + Intronic
1113520127 13:110934631-110934653 CAGGGAGATCAGGGGACAGCAGG + Intergenic
1113784522 13:112995519-112995541 CCAGGAGAGCAGAGGGGAGCTGG + Intronic
1113811393 13:113144504-113144526 CAGGGGCATCAGCGGGCAGGAGG + Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114267281 14:21080436-21080458 AAGGCAGATGAGAGGGAAGCTGG - Intronic
1114268259 14:21085664-21085686 GAGGAAGAGCAGAGGGCAGCGGG - Intronic
1114269444 14:21092051-21092073 CCGGGAGAGCAGAGGACAGCGGG + Exonic
1117291040 14:54333016-54333038 CAGGAAGAGCAAAGAGCAGCAGG + Intergenic
1117690216 14:58298641-58298663 CACGGAGGTCAGAGGGGAGGAGG + Exonic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118298241 14:64590343-64590365 CAGTCAGTTCTGAGGGCAGCAGG + Intergenic
1118334535 14:64841720-64841742 ATGGGATGTCAGAGGGCAGCTGG - Intronic
1118401534 14:65384050-65384072 GCTGGAGATCAGAGGGCAGGAGG - Intergenic
1118818048 14:69326546-69326568 CATGGATATCAGAGGAGAGCTGG + Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119679940 14:76584729-76584751 AAGGGAAATGAAAGGGCAGCAGG + Intergenic
1119859104 14:77923882-77923904 CAGGGAGAGGGGAGGGGAGCAGG + Intronic
1119950430 14:78738822-78738844 CAGGGAAATAAGAAGGCAGATGG + Intronic
1121037215 14:90716260-90716282 CAGGGTGATCAGATAGCAACTGG + Intronic
1121263281 14:92581969-92581991 CAGGGTGATCAGACAGCACCCGG + Intronic
1121640858 14:95484002-95484024 CAGGTGCATCAGAGAGCAGCTGG - Intergenic
1121650067 14:95551668-95551690 GATAGACATCAGAGGGCAGCTGG - Intergenic
1121782728 14:96632185-96632207 CAAGGAGCTCACAGGGCAGTGGG + Intergenic
1121913968 14:97819254-97819276 CAGGGAGACCAGTGGCCTGCGGG - Intergenic
1122153776 14:99738411-99738433 CAGGCAGAGCAAAGGGCAGTGGG - Intronic
1122232978 14:100316302-100316324 CAGGGAGAAATGTGGGCAGCAGG + Intergenic
1122264242 14:100539297-100539319 CCTGGAAATCCGAGGGCAGCTGG + Exonic
1122483991 14:102065981-102066003 CAGGGCCATCAGAGGGCACAGGG + Intergenic
1122943337 14:104993328-104993350 CAGGGAGAGAAGAGAGCTGCAGG + Intronic
1123096502 14:105769419-105769441 GTGGGAGAGCAGCGGGCAGCCGG - Intergenic
1124515163 15:30361612-30361634 CAAGGAGATCAAAGGGACGCAGG - Exonic
1124630148 15:31331553-31331575 CTGGCAGAGCAGAGGGCATCTGG + Intronic
1124727759 15:32169115-32169137 CAAGGAGATCAAAGGGACGCAGG + Intronic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1125523375 15:40360312-40360334 TCCTGAGATCAGAGGGCAGCAGG + Intronic
1125841834 15:42809137-42809159 GAGTGAGAACAGAGGGCAGGTGG - Intronic
1126175958 15:45735874-45735896 CAGGGTGGTCAGATGCCAGCAGG + Intergenic
1126317437 15:47385489-47385511 CAGGGAAAGCAGAGGCCAGGTGG - Intronic
1126989264 15:54353725-54353747 CAGTGAGGTCAGAGGAAAGCTGG - Intronic
1127613792 15:60663061-60663083 CAGGGAGATCAGAGTGGGGGTGG - Intronic
1127812132 15:62573582-62573604 CAGGGAGAGAGGAGGGAAGCTGG - Intronic
1128075176 15:64821342-64821364 CAGTATGTTCAGAGGGCAGCAGG - Intronic
1128346917 15:66859860-66859882 CAGGGTGGTCACTGGGCAGCAGG - Intergenic
1128478918 15:68020583-68020605 CAGGCAGAGCAGAAGGCAGAAGG - Intergenic
1128659545 15:69488184-69488206 CAGGGAGCTCAGAGAGTAGCAGG + Intergenic
1128991349 15:72263133-72263155 TAGGGATATGAGAGGGGAGCAGG - Intronic
1129064603 15:72890265-72890287 CAGAGAGCTGAGACGGCAGCTGG + Intergenic
1129242874 15:74261891-74261913 CAGGCATCTCAGAAGGCAGCAGG + Intronic
1129367414 15:75064845-75064867 CAGGAAGATCAAGGGGCAGCAGG + Intronic
1129535794 15:76312705-76312727 CAGTGAGAGAAGAGGGCAGTGGG - Intergenic
1129665720 15:77578427-77578449 ACGGGATCTCAGAGGGCAGCAGG - Intergenic
1129713979 15:77836366-77836388 CAGGGAAAGGAGAGAGCAGCTGG - Intergenic
1129930253 15:79404624-79404646 TTGGGAGATCAGAGGTCAGAAGG - Intronic
1131123845 15:89841414-89841436 CAGGGAGAGGACAGGGAAGCTGG + Intronic
1131353591 15:91723911-91723933 CCTGGAGCTCGGAGGGCAGCAGG + Intergenic
1132743913 16:1428889-1428911 CAGCTGGATCAGAGGGGAGCTGG + Intergenic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1133346698 16:5075910-5075932 CAGGCAGATCAGAGGAAGGCAGG - Intronic
1133771114 16:8867726-8867748 CAGGGAGTGCAGAGGGCGGTGGG + Intronic
1134131040 16:11650496-11650518 CAGTGGGATCAGAGGCCAGCTGG + Intergenic
1134176465 16:12010821-12010843 CAGGAACAACAAAGGGCAGCTGG - Intronic
1135150670 16:20002528-20002550 GAGAGGGATCAAAGGGCAGCAGG + Intergenic
1135202642 16:20451878-20451900 CAGGGAGAGACGAGGGCAGCTGG + Intronic
1135216461 16:20575988-20576010 CAGGGAGAGACGAGGGCAGCTGG - Intronic
1137664166 16:50239182-50239204 CAGGGAGATGTGAGGTTAGCAGG + Intergenic
1138113063 16:54339876-54339898 CTGGGACCTCTGAGGGCAGCAGG + Intergenic
1138249742 16:55492783-55492805 CAGGGCGGTCAGGGGGCCGCTGG - Intronic
1138350803 16:56345342-56345364 CAGGGAGAACAGAGGGCTTGAGG - Exonic
1138396045 16:56705539-56705561 CCAGGAGGTCAGAGGCCAGCAGG + Intronic
1138415332 16:56868265-56868287 CAGGGGGGTCAGAGGCCACCTGG - Intronic
1138441956 16:57040677-57040699 GAGGCAGCTCAGAGGGCATCTGG - Exonic
1138891715 16:61150673-61150695 CAAGGAGAGCAGAGAGGAGCAGG - Intergenic
1139329486 16:66176350-66176372 CAGGGGGCACAGAGGACAGCAGG - Intergenic
1139548872 16:67662553-67662575 CAGGGAGGGCAGAGAGCTGCGGG - Exonic
1139574106 16:67830585-67830607 CCTGGAGATCAGGGGCCAGCTGG + Intronic
1139594039 16:67947937-67947959 GAGGGAGATTATAGGGCTGCGGG - Intronic
1139595964 16:67958474-67958496 CAGGCTGATCTCAGGGCAGCAGG - Intronic
1140861909 16:79025526-79025548 CAGGGAGCACTGAGGGCTGCTGG + Intronic
1141940596 16:87273539-87273561 CAGGGAGGTCGGGGGGCAGGGGG + Intronic
1142104376 16:88294481-88294503 CTGGGAGCCCAGAGGGCAGGAGG - Intergenic
1142308868 16:89300475-89300497 CAGAGAGAGCAGAGTGCAGCAGG - Intronic
1142359495 16:89619573-89619595 CAGGGGGACCAGGGGGCTGCAGG - Intronic
1142402973 16:89870693-89870715 AAGGGAGAGCAGAGGCAAGCAGG - Exonic
1142605447 17:1078714-1078736 CGGGGAGGTTAGAGGGCCGCAGG - Intronic
1142656418 17:1397563-1397585 CAGAGAGATAAAAGGGCAGCTGG + Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1143003888 17:3814264-3814286 CAGTGAGAGCAGAGGACAGTGGG - Intronic
1143483758 17:7241601-7241623 CTGTGAGATCAGAAGGCACCAGG + Exonic
1143500129 17:7334033-7334055 CAGGGAAGAAAGAGGGCAGCTGG + Intergenic
1143980109 17:10861582-10861604 CAAGGCGATCAGGAGGCAGCGGG - Intergenic
1144440582 17:15277521-15277543 TGGGGAGAGCAGAAGGCAGCTGG + Intergenic
1144580693 17:16457441-16457463 CAGCAAGACCAGAGGGCAGGAGG + Intronic
1144757888 17:17691304-17691326 CATGGACATCAGGGGCCAGCTGG - Intronic
1144774673 17:17779308-17779330 CAGGGAGCGCTGGGGGCAGCGGG + Intronic
1145005876 17:19337453-19337475 CACAGAGAGCAGAGGGCTGCAGG - Intergenic
1145262000 17:21360072-21360094 CAGGGTCATCATGGGGCAGCAGG - Intergenic
1145796998 17:27661266-27661288 CGGGGGGCTCAGAGGGCTGCTGG - Intergenic
1145840431 17:27989697-27989719 CAGGGAGAACAGAAGGCAAGTGG - Intergenic
1146400602 17:32497580-32497602 CAGGGACAACAGAGGGCAGGAGG - Intronic
1146450020 17:32965410-32965432 CAGGAAGATCAAGGGGCAGGAGG + Intergenic
1146842107 17:36163455-36163477 CGGGGGGCTCAGAGGGCTGCTGG + Intergenic
1146854415 17:36251414-36251436 CGGGGGGCTCAGAGGGCTGCTGG + Intronic
1146870318 17:36375306-36375328 CGGGGGGCTCAGAGGGCTGCTGG + Intronic
1146877675 17:36426387-36426409 CGGGGGGCTCAGAGGGCTGCTGG + Intronic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1147073199 17:37975930-37975952 CGGGGGGCTCAGAGGGCTGCTGG + Intergenic
1147084721 17:38055468-38055490 CGGGGGGCTCAGAGGGCTGCTGG + Intronic
1147100668 17:38179434-38179456 CGGGGGGCTCAGAGGGCTGCTGG + Intergenic
1147132105 17:38415630-38415652 CGGGGAGGGCAGTGGGCAGCAGG - Intergenic
1147442977 17:40458658-40458680 CAGGGAGACCAGATGGCTGCAGG - Intergenic
1147475577 17:40708596-40708618 CTCTGACATCAGAGGGCAGCAGG - Intergenic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1147910764 17:43854581-43854603 CAAGGAGATCAGAGGGCACTAGG - Intronic
1148521048 17:48275273-48275295 CAGGGAGATCAGAGAGAATAAGG - Intronic
1149561587 17:57611444-57611466 CAGTGAGCTGACAGGGCAGCAGG - Intronic
1150077628 17:62206735-62206757 CAGGGGCACCAAAGGGCAGCTGG - Intergenic
1150083605 17:62262481-62262503 CAGGGGGCTCAGAGGGCTGCTGG + Intergenic
1150233563 17:63573868-63573890 CAGGGAGCCCAGAGGGGAACAGG - Intronic
1150917672 17:69452990-69453012 CAGGGACATCACAGAGCACCTGG - Intronic
1151483310 17:74383206-74383228 CAGGGAGGCCAGGGAGCAGCTGG + Intergenic
1151670448 17:75569154-75569176 CAGGAAGGGCAGAGGCCAGCTGG + Intronic
1151714681 17:75825297-75825319 CAGGGAGAGCTGGGGGCAGCTGG - Exonic
1151726284 17:75886650-75886672 CAGGGACCTCACAGGCCAGCTGG - Intronic
1151796772 17:76351859-76351881 GAGGGAGAGCAGAGGGGAGCAGG - Intronic
1152233286 17:79125546-79125568 CAGGGAGCTCAGGGAGCAGGCGG + Intronic
1152627010 17:81392530-81392552 CAGGGACATGGGAGGGCAGAGGG - Intergenic
1153540409 18:6147996-6148018 CAGGGAGATCAGAGGTTTGATGG + Intronic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1155292832 18:24358468-24358490 GATGGAGATGAGTGGGCAGCAGG - Intronic
1156309340 18:35908151-35908173 CAAAGAGATCAGCAGGCAGCGGG + Intergenic
1156363761 18:36407074-36407096 CAGGGAAAGCAGAGGACAGCAGG - Intronic
1156448289 18:37252865-37252887 AGGGGCGGTCAGAGGGCAGCAGG + Intronic
1156456396 18:37297046-37297068 CAGGGAGAGAAGAGGGGAGCAGG + Intronic
1157197418 18:45630800-45630822 CAGGAAGATATGGGGGCAGCTGG - Intronic
1157339019 18:46762665-46762687 CAGAGAGGTCAGTGGGCAGGGGG + Intergenic
1158397124 18:57088214-57088236 CAGGGAGACCACAGGGCTGGGGG + Intergenic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1160239775 18:77114853-77114875 CAGGGCGAGCAGTGGGCTGCAGG + Intronic
1160403025 18:78624916-78624938 CAGGGAGGTCAGAGGGCGATGGG + Intergenic
1160579390 18:79875032-79875054 CTGGGAGATCACAGGGCAGAAGG - Intronic
1160673777 19:377918-377940 CAGGGAGATGGGATGGGAGCTGG - Intergenic
1160824229 19:1071901-1071923 CCGGGAGGACAGAGGCCAGCGGG - Intronic
1161948433 19:7453573-7453595 CAGGGAGATCGCAGGGAAGATGG + Exonic
1162230291 19:9260424-9260446 CAGGGAGACCAGAGCCCACCGGG + Intergenic
1162783118 19:13017469-13017491 CAGGCCGATCTGAGGGCAGGTGG + Intronic
1164100513 19:22050860-22050882 TAGAAAGAGCAGAGGGCAGCAGG - Intergenic
1164158726 19:22612481-22612503 CAGGCTGGTCAGAGGGCTGCAGG - Intergenic
1164508917 19:28881950-28881972 GGGGGAGATCAGAAAGCAGCCGG - Intergenic
1164620793 19:29695029-29695051 CAGGGAGAGCTGCGGGCTGCCGG - Intergenic
1164933287 19:32191722-32191744 CAGGGAGAGCACACGGCAGTGGG + Intergenic
1165307253 19:35010270-35010292 GATGGAGATCTGAGGACAGCAGG - Exonic
1166109500 19:40613641-40613663 CAGCAGGATCAGGGGGCAGCTGG + Intronic
1166326519 19:42054225-42054247 CAGGGAGGGCAGAGGGCCACAGG + Intronic
1166550388 19:43662087-43662109 CAGGTGGAGAAGAGGGCAGCAGG - Intronic
1166694786 19:44846385-44846407 CAGGGAGGCTAGAGCGCAGCGGG + Intronic
1167382395 19:49146171-49146193 CAAGGAGATCAGCTGGGAGCAGG + Exonic
1167651776 19:50734890-50734912 GAGGGAGAGAAGAGGGCAGAGGG - Intergenic
1167658424 19:50781305-50781327 CAGGGATTTCTGCGGGCAGCTGG + Intergenic
1167732388 19:51268058-51268080 CAGGGTGTTAGGAGGGCAGCAGG - Intronic
1168355625 19:55698066-55698088 CAGGGTGATCAGAGGTCACCTGG + Intronic
925303748 2:2835070-2835092 CAGGCAGAAGGGAGGGCAGCTGG - Intergenic
925841357 2:7995181-7995203 CAGGTAGATCACAGGGAAGGTGG - Intergenic
925868125 2:8246579-8246601 GAGGGAGACCAGAGTGCAGTGGG - Intergenic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926238686 2:11068867-11068889 CAGGGAAAGCTGAGGGGAGCGGG + Intergenic
926936118 2:18087959-18087981 CAGGGAGATCAGGGGGCAACAGG - Intronic
927542733 2:23927176-23927198 CAGGGAGAGGAGCGAGCAGCCGG - Intergenic
927711798 2:25330750-25330772 CCGGGAGAGCAGAGGGCATGGGG - Intronic
928071716 2:28223606-28223628 CAGGAAGATCAATGGGCAACTGG + Intronic
928414396 2:31079588-31079610 CAGGGAGGTCTGGTGGCAGCAGG - Intronic
928415759 2:31090293-31090315 CAGGGAGCTCTGAGTGCAGTGGG - Intronic
928428453 2:31198760-31198782 CATGGAGATAAGAAGTCAGCAGG - Intronic
928437835 2:31267172-31267194 CTAGGAGATCTGAGGGCAGGCGG + Exonic
928792070 2:34969422-34969444 CAGAGAGATAAGAGAACAGCTGG + Intergenic
929771708 2:44897814-44897836 CAAGGAGTTCAGAGGACAGCAGG + Intergenic
929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG + Intergenic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932655970 2:73611400-73611422 CAGGGAGGTCTGATGGCTGCAGG - Intergenic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
933705112 2:85283864-85283886 CAGCGGGTTCAGATGGCAGCCGG - Intronic
933766464 2:85712581-85712603 CAGGGAGTTCAGGGGAGAGCCGG + Intergenic
934513841 2:94971648-94971670 CATGGACATCAGAAAGCAGCAGG - Intergenic
934985069 2:98879114-98879136 CAGGGAGCTCAGAGTCCAGGAGG - Intronic
935263068 2:101371409-101371431 CAGGGAGAGCAGAGGCCAAAGGG + Intronic
935974105 2:108560383-108560405 AGATGAGATCAGAGGGCAGCAGG - Intronic
936267728 2:111023215-111023237 CAGGGAGATGAGAGGGGAGCGGG + Intronic
936483489 2:112906933-112906955 CAGGGAGATGACAGGAAAGCCGG - Intergenic
936484689 2:112915998-112916020 CAGGGAGATGACAGGAAAGCCGG + Intronic
937104049 2:119293971-119293993 CAGGGACTCCAGCGGGCAGCTGG + Intergenic
937235984 2:120432279-120432301 AAGGGAGCTCAGAGGGGTGCAGG - Intergenic
937271706 2:120656999-120657021 CCTGGACATCAGAGGTCAGCTGG + Intergenic
938070841 2:128307357-128307379 CATGGGGTTCAGAGGTCAGCAGG + Intronic
938082002 2:128375013-128375035 CAGGGACATCGCAGGGCAGCTGG + Intergenic
938341455 2:130539220-130539242 CAGGGAGAGGGCAGGGCAGCGGG + Exonic
938348374 2:130581489-130581511 CAGGGAGAGGGCAGGGCAGCGGG - Intronic
939664041 2:144928353-144928375 CATGGAGGTCAGAGGGCAAAGGG - Intergenic
941244078 2:163075053-163075075 CAGGGAGTTCAGAGAGAAGCTGG - Intergenic
941490112 2:166133209-166133231 CAGGGAAGGCAGAGGGCAACTGG - Intergenic
942311503 2:174661154-174661176 CAGGGAGGCCAGCGTGCAGCAGG + Intronic
942381067 2:175391393-175391415 CAGGTAGATCATATGGCAACTGG + Intergenic
942921561 2:181380337-181380359 CTGTGAGATCTGAGGGCAGTAGG + Intergenic
943801130 2:192059390-192059412 CATGGGGATAAGAGGGAAGCTGG + Intronic
943953867 2:194161852-194161874 CAGGAAGATCAAGGGGAAGCAGG - Intergenic
944176096 2:196830798-196830820 CAGGAAGATCAAGGGGCAGCAGG - Intergenic
946015982 2:216604345-216604367 CAGGGTGATCAGACAGCACCTGG + Intergenic
946041942 2:216790328-216790350 AAGGGAGGGCAGAGTGCAGCTGG + Intergenic
946236503 2:218327521-218327543 TGGGGAGAGCAGAGAGCAGCAGG - Intronic
946340132 2:219061108-219061130 CAGGGGGCGCAGAGGGCAGCGGG - Intergenic
947046245 2:225989964-225989986 TCAGGAGATCAGAGGGTAGCAGG - Intergenic
947074252 2:226324839-226324861 CAGAGAGGACAGAGGGCAGTGGG + Intergenic
947462319 2:230314181-230314203 CAGTGAGTTCAGGGGGCATCTGG - Intergenic
947949256 2:234133752-234133774 CAGGGTGATCAGACAGCACCCGG + Intergenic
948204401 2:236155525-236155547 CAGGGAGACCAGTGGGCACGGGG - Intergenic
948365602 2:237452567-237452589 AAGGCACATCAGATGGCAGCAGG + Intergenic
948619968 2:239228100-239228122 CAGGCACACCAGAGGGCACCAGG + Intronic
948725447 2:239930985-239931007 GAGGGAGGTCAGGGGGCAGTAGG + Intronic
949035940 2:241815781-241815803 CAGAGAGAGCGGAGGGCAGGCGG - Intronic
1169492662 20:6084202-6084224 CAGGGTGATCACAGAGCAGCCGG - Intronic
1170710907 20:18789794-18789816 CAGGGAGAAAAGAGGCCATCAGG + Intergenic
1170743653 20:19079440-19079462 TTGGGATATCAGAGGGCTGCTGG + Intergenic
1170822667 20:19767521-19767543 CTGAGAGACCAGAGGGCAGGAGG + Intergenic
1171187344 20:23132319-23132341 CAGGGAGCTCATATGGCAGAAGG + Intergenic
1171330870 20:24337773-24337795 CAGTGAGGTCAGAGGGGAGCAGG + Intergenic
1172108136 20:32528685-32528707 CAGGGAAACCACAGGGCAGGAGG + Intronic
1172183696 20:33018801-33018823 CCTGGACATCACAGGGCAGCTGG + Exonic
1172763855 20:37340521-37340543 ATGGGAGGGCAGAGGGCAGCCGG - Intergenic
1173841516 20:46160490-46160512 CAGGGTGACCAGATGGCAACAGG - Intergenic
1173923986 20:46767230-46767252 AAGTGAGGTCAGAGTGCAGCTGG + Intergenic
1174109216 20:48186421-48186443 CAGTGAGAAGAGAGGCCAGCAGG - Intergenic
1174283286 20:49454622-49454644 AAGGGAGATAAGAAGGCAGGAGG + Intronic
1174339832 20:49888768-49888790 GAGGGAGATCAGATGGCAGGAGG - Exonic
1175158975 20:56994085-56994107 CAGGGAGGTCAGAGAGGGGCAGG - Intergenic
1175295870 20:57908364-57908386 CAGAGAGGCCTGAGGGCAGCAGG + Intergenic
1175486466 20:59350310-59350332 TAGGGAGATCAGAGGCATGCGGG + Intergenic
1175520690 20:59600785-59600807 CAAGGAGATCAAGGGGCAGAAGG + Intronic
1175613674 20:60373902-60373924 AAGGGAGATGAGCGGGCAGCGGG + Intergenic
1175738848 20:61406452-61406474 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738853 20:61406480-61406502 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738867 20:61406550-61406572 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738880 20:61406620-61406642 CAGGCAGAACAGATGGCAGATGG - Intronic
1175738895 20:61406690-61406712 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738942 20:61406921-61406943 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175973482 20:62698883-62698905 CAGGAAGCCCAGGGGGCAGCAGG + Intergenic
1175973510 20:62698984-62699006 CAGGAAGTCCAGGGGGCAGCAGG + Intergenic
1176101400 20:63366091-63366113 CAGGGAGTTGAGAGCACAGCCGG - Intronic
1179358453 21:40683238-40683260 CAGGGAGGTCAGAGAGAAACTGG + Intronic
1179878404 21:44282997-44283019 AAGGGAACTCAGAGGCCAGCGGG - Intergenic
1180864203 22:19106525-19106547 CAAGGAGCCCAGAGGCCAGCCGG + Intronic
1181005947 22:20013586-20013608 CATGGCCACCAGAGGGCAGCTGG - Intronic
1181174331 22:21027318-21027340 GAGAGAGAGCAGAGGGCGGCAGG + Exonic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181539591 22:23566268-23566290 CTGGGAGAGGAGAGGGCAGGGGG + Intergenic
1181807459 22:25383688-25383710 CAGGCAGAACAGAGGCCACCCGG + Intronic
1182052174 22:27321715-27321737 CAGGGGCATCAGAGGTGAGCTGG + Intergenic
1182217388 22:28730486-28730508 CAGGAGGATCAGATGACAGCAGG + Exonic
1182508571 22:30802899-30802921 CCGCGAGCTCAGAGAGCAGCCGG - Intronic
1183174844 22:36215616-36215638 AAGGGAGAACAGTGGGCAGGAGG - Intergenic
1183495846 22:38143303-38143325 CAGGGTGAGCAGAGGTGAGCAGG + Intronic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184235414 22:43180563-43180585 CTGTGAGCTCAGAGGCCAGCTGG + Intronic
1184592361 22:45493563-45493585 CAGGGAGCTGGGAGGGCAGCTGG + Intergenic
1184795782 22:46731646-46731668 CAGGGAGGGCAGAGGGCACCTGG + Intronic
1184810794 22:46830384-46830406 CTGGGAGATCTGAGGGCTGCTGG - Intronic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185072934 22:48667151-48667173 CAGGGGCAGCACAGGGCAGCAGG + Intronic
1185400133 22:50611303-50611325 CATGGAGCTCAGGGGGAAGCAGG + Exonic
949555434 3:5148477-5148499 CAGGAAAATCAAGGGGCAGCAGG - Intronic
949882949 3:8675872-8675894 CAGAGAGAAAAGATGGCAGCTGG + Intronic
950201952 3:11050758-11050780 CAGGGAGCTCAGGGAGCAGGGGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951456453 3:22897673-22897695 CAGGGATCTCAGAGGCCATCTGG - Intergenic
951530879 3:23697012-23697034 CAAGGAGCTCAGAGGTGAGCTGG - Intergenic
951578308 3:24135668-24135690 CAGGGATATCTGAAGGCTGCAGG - Intronic
953233536 3:41085682-41085704 CTGTGACATCTGAGGGCAGCAGG + Intergenic
953373877 3:42412548-42412570 CAGGGTGAGCAGAGGCCATCAGG - Intergenic
953609094 3:44432774-44432796 CAGGGATGTAAGAGGGAAGCTGG - Intergenic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954618450 3:51982578-51982600 CTGGGAGTACAAAGGGCAGCTGG + Intronic
954805664 3:53218538-53218560 CAGGGAGATCAAGAGGCAACTGG + Intergenic
956091763 3:65675085-65675107 TGGGGAGATCAGAGAGCATCTGG - Intronic
956221980 3:66914189-66914211 TATGGAGGTCAGAAGGCAGCAGG + Intergenic
956260057 3:67329484-67329506 ACAGGAGATCAGAGGGCGGCAGG + Intergenic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
957681374 3:83440111-83440133 CAGGGCTATCAGATGGTAGCAGG - Intergenic
961381539 3:126499083-126499105 CAGTGAGAACAGGGGGCTGCGGG - Intronic
961650212 3:128413404-128413426 CAGGGACCTCAGAGGGCACTGGG + Intergenic
962334611 3:134516076-134516098 AAGGGAACTCAGAGGCCAGCGGG - Intronic
962886666 3:139633974-139633996 CAGAAAGACCTGAGGGCAGCTGG - Intronic
963259596 3:143178695-143178717 AAGGGGGATGAGAGGCCAGCAGG - Intergenic
963751149 3:149181179-149181201 CAGGGAGAGCAGGGGCCAGATGG - Intronic
964843641 3:161023046-161023068 CATGGACATCAGAAGGCAGTGGG - Intronic
964850713 3:161093452-161093474 TAGTGAGAGCACAGGGCAGCTGG + Intronic
964935011 3:162073321-162073343 CAGGGACATCGGAGGTCAGCTGG + Intergenic
966209910 3:177442673-177442695 CAGGAAGATGAGAGGTCTGCTGG - Intergenic
966806241 3:183810010-183810032 CAGGGAGCACAGAGGTAAGCAGG - Intronic
966869422 3:184280464-184280486 CAGAGAGGTCAGCAGGCAGCTGG + Intronic
967430177 3:189374658-189374680 CAGGAGGATGAGAGGGCAGCTGG - Intergenic
967594374 3:191312859-191312881 CTGGGAGTTGTGAGGGCAGCTGG + Intronic
968287047 3:197514854-197514876 CAGGGAAATCACAGGGGAGGTGG + Intronic
968969111 4:3784330-3784352 CAGGGAGCTCTGAGGGAAGCTGG - Intergenic
969465846 4:7355940-7355962 AAGGGAGGGCAGAGGGCAGGTGG - Intronic
969867577 4:10085693-10085715 CAGGGAAGTCTCAGGGCAGCAGG - Intronic
970485538 4:16521100-16521122 CAGGGAGATTAGAGAGAAGCAGG + Intronic
970505415 4:16724335-16724357 CAGGGAGATTTGTGGGCACCTGG + Intronic
970853274 4:20626833-20626855 CAGGGAGGTCAGAGAACAGCTGG + Intergenic
973220738 4:47723277-47723299 CAGGGAGATCACAGAGAAGAGGG + Intronic
973261328 4:48166948-48166970 CTGGGAGGTGAGAGGGCAGGTGG + Intronic
974805806 4:66879069-66879091 CAGGAAGCTCAGTGGGCAGATGG + Intergenic
975041037 4:69744202-69744224 CAGGGTGATACCAGGGCAGCAGG + Intronic
976194869 4:82522868-82522890 CAGGGTGATCAGATGTCACCTGG + Intronic
977591044 4:98827588-98827610 CAAGGACAACAGAGGGCAGAGGG - Intergenic
980522827 4:133954183-133954205 CAGGAAGATCAGGGGGCAAAAGG - Intergenic
980829006 4:138106958-138106980 CAGTGAGAAAAGAGGGCAGCTGG + Intergenic
980838773 4:138231179-138231201 CAGAGAGATGAGAGGGTAGGAGG + Intronic
980952371 4:139394270-139394292 CAGAAAGATCAGAGGACAGAGGG + Intronic
981118573 4:141021153-141021175 CAGGGTGATCAGATATCAGCCGG + Intronic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
984919754 4:184753054-184753076 TGGGGAGCTCTGAGGGCAGCAGG + Intergenic
985492524 5:187911-187933 CTGTCAGGTCAGAGGGCAGCAGG + Exonic
985605387 5:855198-855220 CATGGAGAACAGTGAGCAGCGGG + Intronic
985701778 5:1377956-1377978 CAGAGCGCTCAGAGGGCAGCGGG - Intergenic
985819446 5:2149692-2149714 CAGGCAGGGCAGAGGTCAGCAGG - Intergenic
985837649 5:2282340-2282362 CAGCGAGGTCAAAGGTCAGCAGG + Intergenic
986169174 5:5301942-5301964 CAAGGGGATGAGAGGGGAGCTGG - Intronic
986454546 5:7903309-7903331 CAGGATGATAGGAGGGCAGCAGG - Intronic
986734047 5:10655163-10655185 CAGGGAGAGAAGCGGGCAGAGGG - Intergenic
986751104 5:10788539-10788561 CATGGACAGCAGAGGCCAGCAGG - Intergenic
988602575 5:32653688-32653710 CAGGGTGATCAGACAGCACCTGG - Intergenic
989317673 5:40102029-40102051 CAGTGATATAAGAGGGGAGCAGG + Intergenic
990523176 5:56599510-56599532 CAGGGAGACCTGAGGGGAGGAGG + Intronic
992179992 5:74186384-74186406 AAGGGAGACCAGTGGGCACCGGG - Intergenic
994733718 5:103525553-103525575 AAGGGAGGTCAGAGGTCTGCTGG + Intergenic
995105466 5:108372591-108372613 CATGGAGACCAGAAGGCAGTGGG + Intronic
996078162 5:119222749-119222771 AAGGGAGATGAGATGGCAGAAGG - Intronic
996529459 5:124512394-124512416 CAGGCAGATCAGAAGACAGAAGG - Intergenic
996553592 5:124755053-124755075 CAGGAAGATCAAGAGGCAGCAGG + Intergenic
997064898 5:130548737-130548759 AAGGAAGATCAAGGGGCAGCAGG - Intergenic
997463262 5:134070093-134070115 CAGACAGAGCAGAGGGCTGCTGG - Intergenic
997673598 5:135696009-135696031 CAGAGAGGTCAGTGTGCAGCAGG - Intergenic
997764706 5:136489448-136489470 CATGGAGACCAGAAGGCAGTGGG - Intergenic
998127356 5:139633711-139633733 CGGGGAGGGCAGAGGGGAGCTGG - Intergenic
998503678 5:142654879-142654901 AGGGGAGAGCAGAGGGCTGCAGG + Intronic
998521976 5:142809414-142809436 CAGGAAGAACAGAGTGCTGCTGG - Intronic
999314734 5:150576248-150576270 CAGGGAGAGCAGGGGAGAGCAGG + Intergenic
1000048479 5:157541390-157541412 CAGACAGAGCAGGGGGCAGCAGG - Intronic
1001098153 5:168792203-168792225 CATGGAGGTCAGTGGGCAGCTGG - Intronic
1001359554 5:171067709-171067731 CATGGAGGTCAGAAGGCAGTGGG - Intronic
1001650060 5:173309843-173309865 GAGGGGCCTCAGAGGGCAGCCGG + Intergenic
1002461178 5:179374627-179374649 CAGAGAGCTCAGAGGACATCGGG + Intergenic
1002703292 5:181142456-181142478 CAGTCAGATCAGAGGGCTGAGGG - Intergenic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1004035787 6:11921358-11921380 GTGCGAGATCAGATGGCAGCTGG - Intergenic
1004433918 6:15571725-15571747 CAGGAAGTTCACAGTGCAGCTGG - Intronic
1004698392 6:18055647-18055669 CATGGAGATGAGAGTGCAGAAGG - Intergenic
1005822297 6:29607891-29607913 CAGTGAGGCCAGAGTGCAGCTGG - Intronic
1005841667 6:29748137-29748159 CAGGGAGCTGGGAGGGCAACAGG + Intergenic
1005869372 6:29962813-29962835 CAGGGAGATCAGGGGGCAAAAGG + Intergenic
1005994482 6:30922998-30923020 CGGGGTGAGCAGAGGGCAGCGGG + Intronic
1006186671 6:32185285-32185307 AAGGGGGATGAGAGGCCAGCAGG + Exonic
1006410349 6:33870109-33870131 GAGAGAGAACAGAGGGCAGGTGG + Intergenic
1007150731 6:39688231-39688253 CTGGGAGGCCAGAGGGCAGGAGG + Intronic
1007757371 6:44108613-44108635 CAGGGAGCTCAGTGGGGAGCAGG + Intergenic
1008046865 6:46860028-46860050 CGGGGAGAGCAGTGGACAGCAGG - Intronic
1009910995 6:69926938-69926960 CATGGAGACCAGAAGGCAGTGGG + Intronic
1011002917 6:82611238-82611260 CAGGAAGATCACAAGGCAGAAGG + Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1013179883 6:107708690-107708712 CAGGGAGTTCACAGTGCAGTGGG - Intronic
1014089241 6:117384812-117384834 CTGGCAGATTAGAGGGCAGGAGG + Intronic
1014489962 6:122050621-122050643 CAGAGGGCTCACAGGGCAGCAGG + Intergenic
1014839190 6:126197833-126197855 TTGGGAGAGCTGAGGGCAGCTGG - Intergenic
1016866630 6:148773946-148773968 CGGGGAGGACAGAGGGAAGCTGG - Intronic
1016919976 6:149283146-149283168 GCGGGAGAGCAGAGGGGAGCTGG - Intronic
1017077204 6:150630315-150630337 CAAGGAGATCAGTGGCCAGGAGG + Intronic
1019190488 6:170247964-170247986 CAGGGAGATGAAGGGGCATCTGG + Intergenic
1019453365 7:1111304-1111326 CAGGGAGGACACAGGGTAGCAGG + Intronic
1019521359 7:1461832-1461854 CAGTGAGGCCAGAAGGCAGCGGG - Intergenic
1019645019 7:2124430-2124452 CTGGGAGATGAGTGGGCAGAAGG + Intronic
1019648790 7:2145088-2145110 CAGGGCTCTCAGTGGGCAGCGGG - Intronic
1020276990 7:6630571-6630593 AAGAGTGATCAGAGGGCACCTGG - Intergenic
1021079360 7:16345171-16345193 CATGGAGGTCAGAAGGCAGTGGG + Intronic
1021517925 7:21507425-21507447 CAGGAAAATCAAGGGGCAGCAGG - Intronic
1021522935 7:21554967-21554989 CAGGAAAATCAAGGGGCAGCAGG - Intronic
1022459881 7:30595037-30595059 CAAGGAGATCGGGGGGCAGGAGG - Exonic
1024103077 7:46053210-46053232 CATGGAGTTCAGAAGGCAACGGG - Intergenic
1024113122 7:46166584-46166606 CAGAGAGAGAAAAGGGCAGCAGG + Intergenic
1025005997 7:55355338-55355360 CAGGGTGATCAGAGGTCACCGGG + Intergenic
1025028214 7:55535371-55535393 CAGTGAGCTCAGAGGGCACTGGG + Intronic
1025110379 7:56211501-56211523 CAGGGAGAGGTGAGGGGAGCAGG + Intergenic
1025230969 7:57203201-57203223 CAGGGAGACCAGGGGGAACCAGG - Intergenic
1025777735 7:64573890-64573912 TAGAAAGAGCAGAGGGCAGCCGG - Intergenic
1026794833 7:73359499-73359521 CAGCGAGATGGGACGGCAGCGGG - Intergenic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1027230232 7:76267983-76268005 CAGGGACTTTAGAGGGCAGAGGG - Intronic
1027235172 7:76293778-76293800 CAGGGAGATCAGACACCACCTGG + Intergenic
1027238240 7:76310763-76310785 CAGGGAGAAAAGAGCACAGCTGG + Intergenic
1027357713 7:77375469-77375491 GAAGGAGAGCAGAGGGCAGGAGG + Intronic
1028162377 7:87500114-87500136 GAGGGAGAATAGAGGCCAGCTGG - Intergenic
1028842103 7:95439811-95439833 CTGGGAGAAAAGAGGGGAGCAGG + Intergenic
1029325735 7:99807448-99807470 CAGGAAGATCAAGGGGCAGCAGG - Intergenic
1031214344 7:118870944-118870966 CAGGTAGATCAGGGGGCAACAGG + Intergenic
1031357090 7:120800482-120800504 CAGGGTGATCAGACGTCAGCTGG - Intronic
1031840578 7:126733774-126733796 CAGTGACATCAGAGATCAGCAGG + Intronic
1032188350 7:129747084-129747106 CAGGCAGAGCACAGGGCTGCAGG - Intronic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032989559 7:137377613-137377635 CATGGAGTCCAGAAGGCAGCAGG - Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034367117 7:150560679-150560701 CAGGGAGATCAGTTGGCCACCGG - Intergenic
1034401515 7:150864596-150864618 CAGGGAGAACTGAGAGCAGCAGG + Intergenic
1034816129 7:154173580-154173602 CAGGGAGAGCAGGGAGCAGCGGG - Intronic
1036077575 8:5518884-5518906 CAGAGAAATGAGAGGGCAGCTGG - Intergenic
1038064416 8:23948354-23948376 AATGGAGATCAGAAGTCAGCAGG - Intergenic
1038374227 8:27022265-27022287 CAGGCAGAGCTGTGGGCAGCCGG + Intergenic
1039912475 8:41835946-41835968 CAGGGAGGGGAGAGGGCAGGGGG + Intronic
1040481002 8:47826720-47826742 CAGGCAGCTCAGCAGGCAGCAGG + Exonic
1043890061 8:85644356-85644378 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043891602 8:85656270-85656292 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043892674 8:85663107-85663129 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043892883 8:85714228-85714250 CAGGCTGATGAGAGGGCAGTGGG - Intergenic
1043895570 8:85735682-85735704 CAGGCTGATGAGAGGGCAGTGGG - Intergenic
1043897109 8:85746126-85746148 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043899435 8:85764494-85764516 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043901043 8:85776687-85776709 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043903007 8:85791962-85791984 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043904617 8:85804155-85804177 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043906229 8:85816346-85816368 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043907837 8:85828536-85828558 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1044712694 8:95072865-95072887 CAGGGAGGGCAGTGGGCACCTGG + Intronic
1045314984 8:101035806-101035828 CTGGGAGATTAGAAGGCAGGAGG - Intergenic
1045357930 8:101405766-101405788 GAGGGAGATGAGAGGGAAGAGGG - Intergenic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1045545554 8:103125142-103125164 CAGGGAGATGTAAGTGCAGCAGG - Intergenic
1046768414 8:118095217-118095239 CAGGGATAACAGAGGGCAAAAGG - Intronic
1047346264 8:124031700-124031722 CTGAGAGATAAGAGGGCAGGAGG + Intronic
1047402773 8:124560093-124560115 CACTGAGCTCAGAGTGCAGCTGG - Intronic
1047498799 8:125427241-125427263 GAGGGAGATTAGAAGGCAGGAGG - Intergenic
1047504775 8:125470393-125470415 CAGGGAGATCCAGGGCCAGCAGG + Intergenic
1047928402 8:129702911-129702933 CAGGGAGTTCTGAGGGCAGAGGG - Intergenic
1048516881 8:135119358-135119380 CAGGGACAACAGACAGCAGCAGG - Intergenic
1048517048 8:135120695-135120717 CAAGGACATCAGAAGGCAGAAGG - Intergenic
1048765104 8:137835055-137835077 TAGGTAGCTCAGAGGGAAGCAGG + Intergenic
1049214549 8:141401754-141401776 CAGGGAGCTCAGAGAACAGCAGG + Intronic
1049293220 8:141814826-141814848 CAAGAAGATCAGAGAACAGCTGG - Intergenic
1049300120 8:141865255-141865277 CTGGGAGAGCCGATGGCAGCTGG + Intergenic
1049371913 8:142272008-142272030 CGGGTAGACCAGAGGGCAGGCGG - Intronic
1049479591 8:142815538-142815560 CAAAGGGATCAGAGAGCAGCTGG + Intergenic
1049623109 8:143607898-143607920 AAGGGAGATTAGAGGCCAGGAGG - Intronic
1049811970 8:144579676-144579698 CACAGAGCTCAGAGGACAGCAGG - Intronic
1049822707 8:144645828-144645850 CAGGGGGAGCTGGGGGCAGCAGG + Intergenic
1049866686 8:144943172-144943194 CATGGAGGTCAGAAGGCAGTGGG - Intronic
1051190435 9:14505703-14505725 GAGGGGGAACAGAGAGCAGCAGG + Intergenic
1051692656 9:19732796-19732818 CAGGCAGATGGGAGGGCAGCTGG - Intronic
1052778415 9:32755867-32755889 CAGGGCGATCGGAGGAGAGCTGG - Intergenic
1052821247 9:33139361-33139383 CAGCGAGTTCAGAAGGGAGCAGG - Intronic
1052980532 9:34445290-34445312 CAAGGAGATCAAAGGGGAGTTGG + Intronic
1053440203 9:38109727-38109749 CAGGCTGAAGAGAGGGCAGCTGG + Intergenic
1053736922 9:41107981-41108003 CAGAGAGAAAAGATGGCAGCTGG + Intergenic
1053900931 9:42794875-42794897 CAGGGAGAAGAGTGGGCAGCAGG + Intergenic
1054260715 9:62862668-62862690 CAGGGTGAAGAGTGGGCAGCAGG - Intergenic
1054691450 9:68323416-68323438 CAGAGAGAAAAGATGGCAGCTGG - Intergenic
1054844832 9:69783305-69783327 CATGGAAGTCAGAGGGCAGTGGG - Intergenic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1056705996 9:88953186-88953208 CAGTGGGATCAGTGGGCATCGGG + Intergenic
1057637909 9:96787953-96787975 CAGGGTGATCAGACGTCACCTGG - Intergenic
1057882344 9:98802041-98802063 GCAGGAGATCAGAGGGCAGGAGG - Intergenic
1057929457 9:99180928-99180950 ATGAGAGATCAGAGGGCAGAGGG - Intergenic
1057962550 9:99470576-99470598 AAGGTAGATGTGAGGGCAGCTGG + Intergenic
1059350299 9:113659543-113659565 CAGGGAGATCAGACATCTGCTGG + Intergenic
1059449183 9:114359650-114359672 CAGGGAAAGCAGAGGCCACCAGG - Exonic
1060106979 9:120878659-120878681 CAGGGGGATCAAGGGGCAGAAGG - Intronic
1060931429 9:127491772-127491794 CACACAGATGAGAGGGCAGCAGG + Intronic
1061052904 9:128206554-128206576 CAGGGAGGTCAGAGGTCTCCAGG + Intronic
1061206186 9:129164881-129164903 CAGGGAGCTGGGAGGACAGCAGG + Intergenic
1061275742 9:129568750-129568772 CTGGGAAAGGAGAGGGCAGCGGG + Intergenic
1061887429 9:133598939-133598961 CAGGGAGAGCCCAGGGCAGATGG + Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062501887 9:136855240-136855262 CAGGAGGATCTGAGGGCAGAGGG - Exonic
1062630226 9:137460021-137460043 CAGGCAGTTCACAGGACAGCAGG + Exonic
1186227039 X:7410449-7410471 CAGGCACATCACATGGCAGCAGG - Intergenic
1186440621 X:9583126-9583148 CAGGGTGGTCAGGCGGCAGCAGG + Intronic
1186858821 X:13651602-13651624 CAGGGTGATCAGATGTCACCTGG - Intergenic
1189234661 X:39477889-39477911 CAGGGAGGTGACGGGGCAGCAGG - Intergenic
1191774102 X:64793593-64793615 CAGGCAGATCTGAAAGCAGCTGG + Intergenic
1192757716 X:74064026-74064048 AAGGTAGATCAGAGGTCAGCAGG - Intergenic
1194260875 X:91694065-91694087 CAGAGAGATGAGAAAGCAGCAGG - Intergenic
1194994277 X:100575667-100575689 CAGAAAGATCAATGGGCAGCAGG - Intergenic
1195956676 X:110338631-110338653 AATGAATATCAGAGGGCAGCTGG - Intronic
1199990873 X:152987294-152987316 CAGGGAGAACAGAGCACAGTGGG + Intergenic
1200055586 X:153458316-153458338 CAAGGTGATCTGGGGGCAGCGGG + Intronic
1200160589 X:154006217-154006239 CAGGGAGACCTGATGGGAGCTGG - Intergenic
1200579527 Y:4932867-4932889 CAGAGAGATGAGAAAGCAGCAGG - Intergenic
1201955535 Y:19618415-19618437 CAGTGAAACCAGATGGCAGCTGG + Intergenic
1202075055 Y:21029032-21029054 CAGTGAGATGTGAAGGCAGCTGG - Intergenic
1202128359 Y:21588327-21588349 CAGAGATATCAGAGAGCAGAAGG + Intergenic
1202150931 Y:21843130-21843152 CAGAGATATCAGAGAGCAGAAGG - Intergenic
1202269708 Y:23060106-23060128 CAGGGACCTCAGAGGGCATTAGG + Intergenic
1202422702 Y:24693852-24693874 CAGGGACCTCAGAGGGCATTAGG + Intergenic
1202448087 Y:24976234-24976256 CAGGGACCTCAGAGGGCATTAGG - Intergenic