ID: 909334455

View in Genome Browser
Species Human (GRCh38)
Location 1:74455413-74455435
Sequence ACAGACTATAAATGTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 314}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909334455 Original CRISPR ACAGACTATAAATGTAAAAC TGG Intronic
903309163 1:22439361-22439383 ACAGACAATAAAAGAAAAAATGG - Intergenic
906885058 1:49636104-49636126 ATAGATTATAAATGTAAATATGG + Intronic
908861892 1:68498487-68498509 AGACACTATAAATGTGAAAGTGG - Intergenic
909140355 1:71856680-71856702 ACAGACAATAAATGTTAACATGG - Intronic
909334455 1:74455413-74455435 ACAGACTATAAATGTAAAACTGG + Intronic
910414969 1:86987915-86987937 ACAGACAAAAAAGGTAAAAAGGG - Intronic
911224147 1:95286196-95286218 ACACCCTATAAATATCAAACAGG + Intergenic
911290183 1:96047720-96047742 ACAGAATATAGATATAAAAAAGG - Intergenic
911359563 1:96860170-96860192 ACAGACTTTAAGTCAAAAACAGG - Intergenic
911541949 1:99166974-99166996 AGAGACTATAAATGTCATAGAGG + Intergenic
912084179 1:105978090-105978112 ACAGAATATAATTATAGAACTGG + Intergenic
912256595 1:108065713-108065735 ACAGACAATAAATGAAGAATAGG + Intergenic
912726170 1:112060551-112060573 ACAGAATATGAATCTAAAATAGG - Intergenic
916100382 1:161389173-161389195 ACAGAAAGTAAATGTAAAGCAGG + Intergenic
916103784 1:161415530-161415552 ACAGACTAAATATACAAAACTGG + Intergenic
917181416 1:172302131-172302153 ACAGACTATACCTGGAAAAATGG + Intronic
918017530 1:180650754-180650776 ACAGATAATAAATGAAAAAAAGG - Intronic
918562224 1:185882461-185882483 ACAGAAAAGAAATGTAAAACAGG - Intronic
918647611 1:186921074-186921096 AAAGACTACAAATGTAAATAAGG - Intronic
918889483 1:190247162-190247184 ACACACCATAGATTTAAAACTGG + Intronic
919375474 1:196788296-196788318 ATACAATATAAATGTAAACCAGG + Exonic
919384646 1:196905188-196905210 ACACAATATAATTGTAAACCAGG + Exonic
919385151 1:196912820-196912842 ATACAATATAAATGTAAACCAGG + Exonic
920826608 1:209428866-209428888 ACAGACAATAAAAGAGAAACTGG - Intergenic
921197214 1:212769977-212769999 ACAGACTAAAAGTGAAAAAATGG + Intronic
921413451 1:214862036-214862058 AAAGACTGTTAATGTAAAAGGGG - Intergenic
921781182 1:219166582-219166604 AAAAAGTAGAAATGTAAAACAGG - Intergenic
923845410 1:237725488-237725510 ACAAAATATACATCTAAAACAGG - Intronic
923890191 1:238206171-238206193 ACAGACAATAAAAGGATAACAGG - Intergenic
924225520 1:241918681-241918703 GCAGAATATAACTGTCAAACTGG - Intergenic
1064487114 10:15805019-15805041 ACAGACTCTAAATGCACAAGTGG + Intronic
1064569191 10:16674742-16674764 ACTGAATATAAGTGTAAAGCCGG + Intronic
1066259584 10:33716090-33716112 ACAGACTATGAATGTGAATATGG - Intergenic
1069364134 10:67678676-67678698 ACAGACTTTAAATGAAAAATAGG + Intronic
1071149013 10:82611122-82611144 ACATACTTTAACTGTAACACTGG + Intronic
1071257363 10:83883234-83883256 AGAGAGAATAAAAGTAAAACAGG - Intergenic
1076710247 10:132329496-132329518 ACAGATTATAAAACAAAAACTGG + Intronic
1078321599 11:10339857-10339879 ACAGACTGTACCTGGAAAACTGG + Intronic
1078490957 11:11768160-11768182 ACAGACCTTAAATATGAAACTGG + Intergenic
1078967960 11:16369726-16369748 AGAGACAATAAATGAATAACTGG - Intronic
1079281729 11:19093357-19093379 ATAGACTATAAATATCAAAAAGG - Intergenic
1079569072 11:21920494-21920516 ACACACTATATATGGAAAAGAGG + Intergenic
1079919736 11:26418196-26418218 ATAGGCTAAAAATATAAAACAGG + Intronic
1080015163 11:27497857-27497879 TCAAATTATAAATGCAAAACAGG - Exonic
1080062196 11:27968947-27968969 ACAGGATACAAATGCAAAACAGG - Intergenic
1081287798 11:41293196-41293218 AAGGTCTATAAATGCAAAACAGG + Intronic
1081817885 11:45962393-45962415 ACTGGCTATAAATGTGATACTGG + Intronic
1084997923 11:73000927-73000949 GCAGATTATAAATGTAGCACTGG + Intronic
1085116116 11:73933518-73933540 ACAGACTATAACTTTAAAAATGG - Intergenic
1086812054 11:91322181-91322203 ACAGACTATAACTGGACAATTGG - Intergenic
1087556179 11:99723538-99723560 ACAGAGTATAAATGCAAGATAGG - Intronic
1088471230 11:110189220-110189242 ACAAACTTTAAATGAACAACAGG + Intronic
1088854717 11:113737759-113737781 ACAAATGATAAATGTAAATCTGG - Intronic
1089923315 11:122230931-122230953 ACAGATTCTGAATGAAAAACTGG + Intergenic
1090622422 11:128572635-128572657 ACAGACTTTAAAAGTGAAAATGG - Intronic
1092385984 12:8035996-8036018 ACAGACTATAGAGGTAGAAGTGG - Intronic
1092460555 12:8682383-8682405 ACCGACTATAAATGAAGTACAGG - Intronic
1094631702 12:32182101-32182123 AAAGAATATCAATGTAAAACAGG + Intronic
1095282161 12:40365822-40365844 AAAGTCTATAAATGAAAAATAGG - Intronic
1095745582 12:45654708-45654730 GCAGATTAAAAAAGTAAAACAGG + Intergenic
1095802574 12:46283747-46283769 ACAGACTGTACATGGAAAAATGG + Intergenic
1096223609 12:49849102-49849124 ACAGATTGTAAAAGAAAAACAGG + Intergenic
1097163116 12:57064025-57064047 ACAGCCTATAAACGTACAAAAGG + Intronic
1097486001 12:60201510-60201532 ACAGACTGAATATGCAAAACAGG + Intergenic
1097703413 12:62843567-62843589 ACAGACTATAAATAAAACACAGG + Intronic
1097830613 12:64221140-64221162 AGAGAATAGAAATGTAAAATTGG - Intronic
1097966955 12:65591419-65591441 AAATAAAATAAATGTAAAACAGG + Intergenic
1098157657 12:67616756-67616778 ACAGACTATAAACATAAAAAAGG - Intergenic
1099265242 12:80438044-80438066 ACAGCCCATAAAAGTAAAAGAGG - Intronic
1099307684 12:80978358-80978380 ACTGTCTATAATTGTAATACAGG + Intronic
1099612831 12:84896730-84896752 ACAGAATATAAATATACACCAGG + Intronic
1100121509 12:91374086-91374108 TCAGAAAATAAACGTAAAACAGG - Intergenic
1100394734 12:94174759-94174781 ACAGACCAAAAAGTTAAAACAGG + Intronic
1102488727 12:113276066-113276088 ACAGACTATACATGAACAAATGG - Intronic
1103089620 12:118088432-118088454 ACAGACAATAAAACTAACACTGG + Intronic
1103897536 12:124283262-124283284 ACAGAAAATAAATCTGAAACGGG + Intronic
1106370019 13:29123114-29123136 AGAGAATATTAATGCAAAACAGG - Intronic
1108204846 13:48078104-48078126 ACAGACTTTAAATGTAACTTGGG - Intronic
1109303769 13:60616792-60616814 ACAGACTAAAAAAGAAAAAAAGG - Intergenic
1109428228 13:62197014-62197036 ACAGTATATAAATGCAAAACAGG - Intergenic
1109467598 13:62757641-62757663 AAAGACAACAAAAGTAAAACTGG - Intergenic
1109685582 13:65815177-65815199 ACAGACTATAAATATTAAAATGG - Intergenic
1109731138 13:66415809-66415831 AAAGACAAAAAGTGTAAAACTGG + Intronic
1110487427 13:76062979-76063001 ACAGTCTAAAAATAAAAAACAGG + Intergenic
1110588635 13:77226479-77226501 ACACAGAATAAATGTAAATCTGG + Intronic
1111361469 13:87184010-87184032 ACAGACAATAAATATATAAAGGG - Intergenic
1112815954 13:103273718-103273740 AAAGTTTATAAATGCAAAACTGG + Intergenic
1114051833 14:18926090-18926112 AAAAACTATCAATGTAAACCAGG - Intergenic
1114110726 14:19475831-19475853 AAAAACTATCAATGTAAACCAGG + Intergenic
1114162555 14:20185249-20185271 ACAAACTATAAATATACCACTGG + Intergenic
1114689714 14:24569316-24569338 ACAGACTTTAAATAAAAAGCAGG + Intergenic
1115414437 14:33114733-33114755 AGCTACTATAAATGTCAAACTGG - Intronic
1115835001 14:37392363-37392385 GGATACTATTAATGTAAAACTGG - Intronic
1116414116 14:44659979-44660001 TCAGAATATAAATGAAAGACAGG + Intergenic
1116477940 14:45363494-45363516 ATTGAGTACAAATGTAAAACTGG - Intergenic
1116516263 14:45810245-45810267 TCACAGGATAAATGTAAAACTGG + Intergenic
1117200107 14:53381471-53381493 CCAAAATATAAATGTAAAACAGG + Intergenic
1117847511 14:59927020-59927042 CCAGAATACAAATGTAAAGCTGG - Intronic
1120344792 14:83272499-83272521 ATAGACTATAAGGGTAAAACAGG + Intergenic
1120360503 14:83494861-83494883 AGAGACAATAAATCGAAAACTGG - Intergenic
1120639691 14:86995802-86995824 AAGGACTTTAAATGCAAAACAGG - Intergenic
1121459357 14:94062226-94062248 GCAGACTGGAAATCTAAAACAGG - Exonic
1124040860 15:26102097-26102119 ACAGACTGTAGATGAAATACAGG - Intergenic
1124601041 15:31133016-31133038 ACAGACTAATACAGTAAAACTGG + Intronic
1125388226 15:39161950-39161972 ACAGACTTTAAATCAAAACCTGG - Intergenic
1126040239 15:44583509-44583531 ATATACTATCAATGTAAGACTGG + Intronic
1127372699 15:58355813-58355835 ACAGACAAGAAATATAAAGCTGG + Intronic
1127620591 15:60730006-60730028 ACAGGAGATAAATGTAAAAAGGG - Intronic
1127742633 15:61927568-61927590 ACAGTGTAAAAGTGTAAAACAGG - Intronic
1130015677 15:80184555-80184577 AAAGCCTATTAAAGTAAAACTGG - Intronic
1130525687 15:84704403-84704425 AGAGACAATAAATCGAAAACTGG - Intronic
1131581020 15:93643675-93643697 AAAAATTATAAATGTAGAACTGG + Intergenic
1131643588 15:94318236-94318258 AAATTCCATAAATGTAAAACAGG - Intronic
1132259723 15:100412132-100412154 ACAGACAATAAATGAAAAAATGG - Intronic
1138783463 16:59816673-59816695 ACAGACTTTAAGTTAAAAACTGG + Intergenic
1138992306 16:62406313-62406335 ACTGACTATAAAGGTGAAAATGG - Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1141531876 16:84651960-84651982 ACAGATTCTAAAAGAAAAACTGG + Intronic
1141869315 16:86773747-86773769 AGAGACTATAGGTGAAAAACAGG + Intergenic
1146707577 17:35012535-35012557 ACAGGCTAAAAAGATAAAACTGG + Intronic
1147482665 17:40781785-40781807 AAAGCCTATAAATATATAACTGG + Intronic
1151405647 17:73884484-73884506 ACAGACTATAAAAATAAACCAGG + Intergenic
1153386019 18:4497217-4497239 ACAGACTAAAAATGATATACTGG - Intergenic
1153407547 18:4758010-4758032 ACAGACTTTAAATCTAATAAGGG - Intergenic
1154002206 18:10491565-10491587 ACAATCTCTAAATGTAAAATTGG + Intergenic
1154084025 18:11284640-11284662 ACACCCTATAAATGTAATACAGG + Intergenic
1155129691 18:22920356-22920378 ACTGCCTATAAATCCAAAACTGG + Intronic
1156127947 18:33930802-33930824 AAAGAATATAAATGTATATCAGG + Intronic
1156194821 18:34762529-34762551 AAAGACCACACATGTAAAACTGG + Intronic
1156732273 18:40208303-40208325 ACAGAAAATAGATATAAAACAGG + Intergenic
1157137518 18:45071280-45071302 ACAGAGTATAATTGTCAACCAGG + Intergenic
1157144943 18:45152603-45152625 ACAGCCTATAAAACAAAAACAGG - Intergenic
1157581996 18:48779042-48779064 CCAGTTTATAAATGGAAAACTGG - Intronic
1157894203 18:51448463-51448485 TCAGACTAGAAAGGGAAAACAGG - Intergenic
1158917887 18:62154290-62154312 ACAAACTAGAAACGAAAAACAGG + Intronic
1158972496 18:62681078-62681100 ATATCCTATAAATGTAAAATGGG - Intergenic
1159090999 18:63849007-63849029 ACAGATAATAAATGAAAAAAAGG + Intergenic
1159176621 18:64844357-64844379 ACACAATACAAATGTAATACAGG + Intergenic
1159561418 18:69999285-69999307 ACAGAATATAACTTTAAACCAGG + Intergenic
1159600944 18:70428141-70428163 ACAGCCTTTAAATGAAAAGCAGG - Intergenic
1159894429 18:73983007-73983029 ACATACAATAAATGTAAATGTGG + Intergenic
1160116958 18:76087793-76087815 ACAGATTACAAACGTAAAAACGG + Intergenic
1160507424 18:79434962-79434984 GGAGACTTTAAATGTCAAACGGG - Intronic
1160972514 19:1775807-1775829 ACATACTAGAAATATAAACCGGG + Exonic
1162840280 19:13351288-13351310 ACACAAGATAAATGAAAAACAGG - Intronic
1163871175 19:19822523-19822545 ACAAAATATATATGTAAATCTGG - Intergenic
1163896295 19:20063423-20063445 ACAAAATATATATGTAAATCTGG - Intergenic
1163906483 19:20153064-20153086 ACAAAATATACATGTAAAACCGG - Intergenic
1163948926 19:20566216-20566238 ACAAAATATATATGTAAATCTGG - Intronic
1163969167 19:20775843-20775865 ACAAAATATATATGTAAATCTGG + Intronic
928562194 2:32501069-32501091 ACAGCATATAAATTTAACACTGG - Intronic
928672797 2:33619832-33619854 TCAGACTTTAAATGTATAAAAGG - Intergenic
929485861 2:42353583-42353605 ACAGATTATAAATGTTTTACTGG - Intronic
929658765 2:43761193-43761215 CAAGACTATAGATATAAAACTGG - Intronic
929862027 2:45686785-45686807 ACAGAATAGAAATGGAAAATTGG + Intronic
929945933 2:46371778-46371800 CCTGACTTTAGATGTAAAACTGG + Intronic
930328972 2:49958408-49958430 ACAGACTGTAAATGCAAGGCTGG - Intronic
930929114 2:56859470-56859492 ACAGATTATAAACCAAAAACAGG - Intergenic
931252085 2:60541115-60541137 ACAGACAGTTAATGTAAAAATGG - Intronic
931305149 2:61021280-61021302 ACAGACTATACCTGGAAAAATGG + Intronic
936126876 2:109795604-109795626 AAAGACTCTAAATGTAAGAGAGG - Intronic
936217821 2:110575882-110575904 AAAGACTCTAAATGTAAGAGAGG + Intronic
937160152 2:119752917-119752939 ATACACCATCAATGTAAAACAGG - Intergenic
937978665 2:127597477-127597499 ACATTCTAGAAATGTAGAACAGG - Intronic
938394708 2:130935445-130935467 TTAGACTAAAAATGTAAAATTGG + Intronic
939268111 2:139902173-139902195 CCAGAGTAGAAATGTAAAACTGG + Intergenic
939571432 2:143845025-143845047 ACAGGCTATAAAGGTCAAAATGG + Intergenic
939670861 2:145010471-145010493 AAAGACTCCAAATGTAATACTGG + Intergenic
939919803 2:148096112-148096134 ACAGACTATAAACATTTAACTGG + Intronic
940141711 2:150498425-150498447 ACTGACTATAAAGGGAAAAGTGG - Intronic
940162841 2:150731977-150731999 ACAGATGATAAATTGAAAACTGG + Intergenic
940514381 2:154662479-154662501 AAAGACTTTATATGTAAAACTGG + Intergenic
940524894 2:154800851-154800873 ACAGTATATAAAAGTATAACTGG + Intronic
941315596 2:163988279-163988301 ATAGAGTATAAATGTAGAAAGGG + Intergenic
942234015 2:173886871-173886893 ACAGACTTTAATGGAAAAACTGG + Intergenic
943233080 2:185282433-185282455 ATGCACTATAAATATAAAACAGG + Intergenic
944135159 2:196391143-196391165 AGAGACTATATATTTAGAACTGG - Intronic
946916869 2:224531963-224531985 ACAGACAATAAAGAGAAAACTGG + Intronic
948036880 2:234864867-234864889 ACTCAATATAAATGCAAAACTGG - Intergenic
1168973666 20:1948030-1948052 CAAGACAATAAATGTAAAAGTGG + Intergenic
1170028975 20:11924253-11924275 TCAGAATATCAATGTAAAATTGG + Exonic
1170096313 20:12649503-12649525 ACAGTTTATAGATGTTAAACTGG + Intergenic
1170182793 20:13551830-13551852 GCAAACAATAAATTTAAAACAGG + Intronic
1171058100 20:21927545-21927567 ACAGAGAATAAAAGAAAAACTGG - Intergenic
1173503983 20:43572826-43572848 ACATACCATCAATATAAAACTGG + Intronic
1173689511 20:44949307-44949329 ACACACTATAAACTTAAAGCAGG + Intronic
1174919430 20:54685917-54685939 ATAGACTATAAATGGACAAGAGG - Intergenic
1177446171 21:21199109-21199131 ACAAACTATAAATGAAAATAGGG - Intronic
1177636383 21:23792415-23792437 AAAGAAAATAAATGTAAAAATGG + Intergenic
1178048574 21:28723573-28723595 AGAGATTAAAAATCTAAAACAGG + Intergenic
1180470306 22:15648469-15648491 AAAAACTATCAATGTAAACCAGG - Intergenic
1182200475 22:28563623-28563645 ACTGACTATAATTTTAAAAATGG + Intronic
1183004052 22:34885563-34885585 TCAGACTACAAATGCAAAATGGG + Intergenic
1183754874 22:39751893-39751915 ACAGAGTATAAATGTAGTAAAGG - Intronic
1184159026 22:42687056-42687078 ACAAACTCTAAATCTAAAATCGG + Intergenic
949245279 3:1919388-1919410 ACAGACTATACCTGGAAAAACGG - Intergenic
949248486 3:1954031-1954053 ATAGAATATACATGTATAACAGG + Intergenic
951006245 3:17618784-17618806 ACAGACTATACCTGGAAAAACGG - Intronic
951292852 3:20894667-20894689 AAAGACTATAAATAAAAAAAGGG + Intergenic
951369243 3:21825432-21825454 ACAGATTATAAAACTAAAATTGG + Intronic
951750705 3:26032708-26032730 ACAGACTATAAAAAGGAAACTGG + Intergenic
952586391 3:34898029-34898051 AAAAACTTTAAATCTAAAACAGG - Intergenic
955361682 3:58281478-58281500 ACAGACTGTACCTGGAAAACTGG - Intronic
956188778 3:66587939-66587961 ATAGACTATATATTTAAAAATGG + Intergenic
956373266 3:68587026-68587048 ACAGACTGTACTTGGAAAACTGG - Intergenic
956543310 3:70369501-70369523 AAAGAATATAAAAGTAATACAGG - Intergenic
957816091 3:85299273-85299295 AGCACCTATAAATGTAAAACTGG + Intronic
958459679 3:94379105-94379127 CCAGACAAAATATGTAAAACAGG + Intergenic
958618463 3:96526901-96526923 ACAGACTGTACCTGTAAAAACGG + Intergenic
959589951 3:108068045-108068067 ACAGACCATAAATGGTAATCAGG + Intronic
960836721 3:121914242-121914264 ACACACTATAAATAGAAAATGGG + Intronic
960946172 3:122968184-122968206 ACAGAGTATTAGTGTAAAAAGGG + Intronic
960956175 3:123033076-123033098 AAAAACTAGAAATGTAACACAGG - Intergenic
961096861 3:124164723-124164745 ATAAAATATAAATATAAAACAGG - Intronic
962565529 3:136655107-136655129 ACAGACAACAAAAGAAAAACAGG + Intronic
963076332 3:141350205-141350227 ACAGACTACAAATGTCATAGAGG - Intronic
963483967 3:145912696-145912718 ATAGACTTTAAATAGAAAACTGG - Intergenic
966543048 3:181113681-181113703 AGATACTAAAAATGGAAAACTGG + Intergenic
966751953 3:183330796-183330818 ACACACTAAGCATGTAAAACTGG + Intronic
968298398 3:197594640-197594662 ACAGACTTTAAATGTTGTACTGG - Intergenic
970056859 4:11983612-11983634 CCAGACAATGTATGTAAAACAGG + Intergenic
971135846 4:23867652-23867674 ACAGACTATAAATGAAAGTAAGG + Intronic
971195319 4:24467843-24467865 CCAGACTAGAAATATAAAAATGG - Intergenic
972330382 4:38058602-38058624 CCAGAATATAAATGTAAAACAGG - Intronic
973656149 4:53049988-53050010 ACAGGCTATAGATGTTAAACAGG + Intronic
974775149 4:66470679-66470701 ACAGACAATAAATTCAAAATAGG - Intergenic
975875721 4:78834652-78834674 AGAGAATGTAAATGTAAACCAGG - Intronic
976609479 4:87015212-87015234 ACAGACTGTAAATGAGTAACAGG - Intronic
978798796 4:112734813-112734835 AAATACTATAAAAGTAAAAATGG - Intergenic
980151958 4:129059051-129059073 ACAGACATTAAATCAAAAACTGG - Intronic
980180000 4:129391737-129391759 AGAGTCTATAAATGTGAAAGGGG - Intergenic
980783027 4:137516445-137516467 ACAGCTTATAAATGTAAAGGTGG + Intergenic
981988233 4:150883881-150883903 ACATACTATAAAAGCAAAATAGG + Intronic
982331707 4:154188047-154188069 ACATATTATAAATGGAAAACTGG - Intergenic
982945968 4:161622910-161622932 ACAATCTATAAATATAAAGCTGG + Intronic
983655137 4:170075195-170075217 AATGTCTATGAATGTAAAACCGG - Intronic
983989037 4:174096362-174096384 AAAGAATATAAAAGTTAAACTGG - Intergenic
987687000 5:21217870-21217892 ATAATCTATAAATGTAAAAGAGG + Intergenic
987972147 5:24960623-24960645 AGAGAGAATAAATGTAAAACTGG + Intergenic
988040604 5:25884488-25884510 TCAGAAAATAAATATAAAACTGG - Intergenic
989686621 5:44095803-44095825 ACTGACAATAAATATAAAAATGG + Intergenic
990388266 5:55290540-55290562 ACTGACTGTAAAAGAAAAACTGG + Intronic
991200029 5:63980786-63980808 ACAGACTATACTTGGAAAATCGG - Intergenic
992621232 5:78595223-78595245 ACAGACTATATTTTTACAACAGG + Intronic
993322478 5:86489351-86489373 ACAGCCTATAAATTGAAGACTGG + Intergenic
993494207 5:88588757-88588779 ACTGACCTTAAATGTAAAATGGG + Intergenic
993919057 5:93777453-93777475 ACAGACTTAAAATGTATAAAAGG - Intronic
995690478 5:114820166-114820188 AAATACTATAAATGAACAACTGG + Intergenic
995937586 5:117535416-117535438 ACAGATTAAAAATGTCAAACCGG + Intergenic
996775633 5:127129455-127129477 TCTGACAATAAATGTAAAAATGG + Intergenic
996858082 5:128032143-128032165 AAAGACTAAAAATGTCCAACAGG + Intergenic
997187701 5:131898808-131898830 ACAGACTGTACATGGAAAAACGG - Intronic
999034516 5:148332615-148332637 ACAAAATATCAATGTTAAACAGG + Intronic
1000120406 5:158192424-158192446 ACAGTCTAAAAATCTAAGACTGG + Intergenic
1002008542 5:176257151-176257173 TCAAACTATAAAAATAAAACAGG - Intronic
1002218181 5:177655100-177655122 TCAAACTATAAAAATAAAACAGG + Intergenic
1005378872 6:25213792-25213814 ACAGAAAATAAATTTAAAAAAGG + Intergenic
1009742826 6:67769572-67769594 ACAGACTATCCAGCTAAAACTGG - Intergenic
1011100436 6:83714388-83714410 ATAGACAATAGATTTAAAACTGG + Intergenic
1012560508 6:100574697-100574719 AAAGAATAAAAATTTAAAACAGG + Intronic
1012599941 6:101083212-101083234 ATTGACTCTAAATGTAAAAATGG + Intergenic
1013193323 6:107822737-107822759 ACAAACTATAACTTTTAAACAGG - Intronic
1015151399 6:130043097-130043119 ACAGCCTATAAATGCAGAAATGG + Intronic
1019208873 6:170388248-170388270 ACACACCAAAAATGTAAGACAGG - Intronic
1019584667 7:1792221-1792243 ACTGAATATAAATTTAAAACCGG + Intergenic
1021282711 7:18740151-18740173 ACAGACTGTACCTGAAAAACGGG - Intronic
1021293487 7:18874847-18874869 TCTGCCTTTAAATGTAAAACAGG - Intronic
1021621648 7:22555480-22555502 AGAGACAATAAATGGATAACTGG - Intronic
1023159642 7:37284809-37284831 AGAGACAATAAATGAATAACTGG - Intronic
1024336158 7:48207822-48207844 ACAGACAACAAAAGTAAAAATGG - Intronic
1027616326 7:80429335-80429357 ACAGACCAGAAATGTAAAAATGG + Intronic
1027705308 7:81525700-81525722 AAAGACAATAATTGGAAAACTGG - Intergenic
1027818346 7:83008684-83008706 AAAGACTAAAAATGTATAATAGG + Intronic
1027844429 7:83354320-83354342 ACAGAATATAGATGTAGGACAGG + Intergenic
1028873203 7:95791742-95791764 AGAGATTAAAAATGTAAATCAGG + Intronic
1029934123 7:104405326-104405348 ACTTACTAAAAATGTAAAATCGG + Intronic
1030217752 7:107063477-107063499 ACAGACAATAAACATAAAACAGG + Intronic
1030531438 7:110716034-110716056 ACAGACTTTAAATGAACAACAGG - Intronic
1030755189 7:113279010-113279032 TCAGGCTATAAATGTATAAAGGG + Intergenic
1030892918 7:115023036-115023058 AAATACTATAAATTTATAACTGG + Intergenic
1031490518 7:122382052-122382074 GCAGAATATATATGTAAAATGGG - Intronic
1031544118 7:123031547-123031569 AAAGACTATACATGTAAAACAGG + Intergenic
1034394179 7:150807788-150807810 ACAGACTATACCTGGAAAAATGG + Intergenic
1034841730 7:154403756-154403778 AAAGACCAGAAGTGTAAAACAGG - Intronic
1035119339 7:156552348-156552370 ACAGACAATAAAGGAAAATCAGG + Intergenic
1035440315 7:158891801-158891823 TCAGAATATATATGCAAAACTGG + Intronic
1035903213 8:3480056-3480078 ACAGACTACAAATGGAAAAGGGG + Intronic
1036437847 8:8751718-8751740 ACAGAAAATAAATTTAAATCAGG - Intergenic
1037600022 8:20385971-20385993 ACAGAATAAGAATGTAAACCTGG - Intergenic
1038615568 8:29090676-29090698 AAAGTATATAAATCTAAAACTGG - Intronic
1039229807 8:35431203-35431225 AAAGACCATAAGTGTAAAAAGGG + Intronic
1040418465 8:47217751-47217773 AGAGACTACAAATGTAACAATGG + Intergenic
1040644315 8:49380509-49380531 ACAGAATATAAATGCAGACCAGG + Intergenic
1041293035 8:56325489-56325511 ACAGACTATACACTTAAAATGGG - Intergenic
1041912670 8:63105310-63105332 ACAGACCACAAATAGAAAACAGG + Intergenic
1043996215 8:86820450-86820472 ACACACTATAAATGTACACCAGG + Intergenic
1044312063 8:90705101-90705123 ACAAACTATACATCTAACACAGG - Intronic
1045181354 8:99786616-99786638 ACAAACTCTAAACATAAAACAGG + Intronic
1046056036 8:109080308-109080330 AAAGACTATAAAAGGAAAACTGG + Intergenic
1046167441 8:110455205-110455227 ACAGACAATAAAAGCAAAAACGG - Intergenic
1046505012 8:115125913-115125935 AAATACTATAAATTTAAAAATGG - Intergenic
1048774121 8:137926342-137926364 AGAGACAATAAATTGAAAACAGG + Intergenic
1048919652 8:139216451-139216473 ACATACTTTAAATGTAAACATGG + Intergenic
1049484819 8:142850194-142850216 ACAGACTATACCTGGAAAATCGG + Intronic
1051129160 9:13840318-13840340 ACAGTCTAACAATATAAAACAGG + Intergenic
1051977693 9:22972494-22972516 ACAGACTGTAAATACCAAACTGG + Intergenic
1052071208 9:24083424-24083446 ACAGACTTAACATTTAAAACAGG - Intergenic
1052580452 9:30348696-30348718 ACAAACTATAAATATAATAAAGG + Intergenic
1052583427 9:30391747-30391769 ACAGACTTTAATTTTAAAAAGGG + Intergenic
1054956163 9:70913057-70913079 GCAACCTATAAATGTAGAACAGG + Intronic
1056117833 9:83458812-83458834 ACAGACACTAAATGAAAAAAGGG + Intronic
1056183846 9:84112071-84112093 AGAGACTATGAATGAAAAGCAGG - Intergenic
1056341655 9:85640686-85640708 ACAAACTATAATTAGAAAACAGG + Intronic
1057933210 9:99214045-99214067 ACAAACTATATATCTCAAACAGG + Intergenic
1058042254 9:100315548-100315570 ACAGACTTCAAATCAAAAACAGG - Intronic
1058614297 9:106809418-106809440 ACAGACTGTAGCTGGAAAACCGG + Intergenic
1059059448 9:111019905-111019927 AGAGGCTAGAAATGTAATACAGG + Intronic
1059229131 9:112701751-112701773 AGATACTATAAATATAAAATAGG + Intronic
1060317777 9:122528968-122528990 ATAGACTCTAAATATAAATCAGG - Intergenic
1203535131 Un_KI270743v1:29072-29094 ACACTGTATAAATATAAAACAGG + Intergenic
1185806203 X:3059547-3059569 ACAGACTGTACCTGGAAAACTGG + Intronic
1186864522 X:13706245-13706267 CCAGACTATTAATGTTAAAGAGG - Intronic
1187570945 X:20500988-20501010 TCAGACTATACATTTAAAATAGG - Intergenic
1187583896 X:20638900-20638922 AGAGAATATAAGTGCAAAACTGG - Intergenic
1187838889 X:23465080-23465102 AGATACTATAAATTTTAAACCGG - Intergenic
1188224873 X:27585112-27585134 AGAGACAATAAAAGTAAACCAGG - Intergenic
1188314540 X:28657062-28657084 CCAGACTATAAATGTAATGGGGG + Intronic
1189860935 X:45271207-45271229 ACAAACTATTAAGGTAAACCAGG + Intergenic
1190434824 X:50413330-50413352 ACAGGCAACAAATGCAAAACTGG + Intronic
1190502272 X:51091309-51091331 ACACACTAGAAATGCAGAACTGG + Intergenic
1190979502 X:55443471-55443493 ACAGACTATACCTGGAAAAATGG + Intergenic
1193107339 X:77691398-77691420 ACAGGGTATAAATGGAAAAGAGG + Intronic
1193349534 X:80444536-80444558 AGAGACTCTAAATGGCAAACAGG + Exonic
1193650650 X:84127086-84127108 CCAGACTATCAAAGAAAAACAGG + Intronic
1193866193 X:86733274-86733296 ACAGACTTTAAATCCAAAAGTGG + Intronic
1194521154 X:94920029-94920051 AAAGACCATAATTGGAAAACTGG + Intergenic
1195623783 X:106986454-106986476 ACACTTTATAAATGTAAAAAAGG + Intronic
1195860374 X:109376566-109376588 AGAGAGTAGAAATGGAAAACAGG + Intronic
1196230216 X:113212417-113212439 ACAGACTATACGTGGAAAAATGG - Intergenic
1197695444 X:129544865-129544887 ACAGACTAGATTTGTATAACAGG + Intronic
1199466045 X:148138392-148138414 ACAGACTATATTTGTATACCTGG - Intergenic
1200380893 X:155835833-155835855 ACAGACTATATATCCAAAAAAGG + Intergenic
1201644602 Y:16216165-16216187 ACACAATATAAAGGTAAAAATGG + Intergenic
1201658213 Y:16369156-16369178 ACACAATATAAAGGTAAAAATGG - Intergenic