ID: 909335139

View in Genome Browser
Species Human (GRCh38)
Location 1:74464658-74464680
Sequence CTGTGTACACAGATGAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909335139_909335142 12 Left 909335139 1:74464658-74464680 CCCAGTCTCATCTGTGTACACAG 0: 1
1: 1
2: 0
3: 9
4: 198
Right 909335142 1:74464693-74464715 AGAAAAATGAAGATCGTTTTGGG 0: 1
1: 0
2: 1
3: 33
4: 437
909335139_909335143 18 Left 909335139 1:74464658-74464680 CCCAGTCTCATCTGTGTACACAG 0: 1
1: 1
2: 0
3: 9
4: 198
Right 909335143 1:74464699-74464721 ATGAAGATCGTTTTGGGATGTGG 0: 1
1: 0
2: 0
3: 6
4: 169
909335139_909335141 11 Left 909335139 1:74464658-74464680 CCCAGTCTCATCTGTGTACACAG 0: 1
1: 1
2: 0
3: 9
4: 198
Right 909335141 1:74464692-74464714 AAGAAAAATGAAGATCGTTTTGG 0: 1
1: 0
2: 1
3: 42
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909335139 Original CRISPR CTGTGTACACAGATGAGACT GGG (reversed) Intronic
903690324 1:25168775-25168797 TTCTGTAAACAGTTGAGACTCGG - Intergenic
904356312 1:29942408-29942430 CTGAGTGCACAGTTGACACTCGG + Intergenic
905167843 1:36093503-36093525 CTGAGTACACCGGTGAGGCTGGG + Exonic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
907271928 1:53296367-53296389 CTGGGTGCACAGAAGGGACTTGG + Intronic
908923927 1:69230380-69230402 CTGTGAACTCAGATGAGTCAAGG - Intergenic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
910465621 1:87496200-87496222 CTGTTAACACAGAAGAGACCAGG + Intergenic
912143825 1:106766564-106766586 CTGTGAACTCAGATGTGACTAGG + Intergenic
912685641 1:111760836-111760858 CTGTACACACCTATGAGACTTGG - Exonic
914360433 1:146931282-146931304 CTGTTAACACAGAAGAGACCAGG + Intergenic
914493314 1:148168616-148168638 CTGTTAACACAGAAGAGACCAGG - Intergenic
919499542 1:198318838-198318860 CTGTGTACACAATTGAGGATTGG + Intronic
919840468 1:201605598-201605620 TTGTTTAGACAGATGGGACTGGG + Intergenic
920871818 1:209801322-209801344 CTGTGTAGCCAGATGAGCCCAGG + Exonic
921162677 1:212484207-212484229 CTGTTTACAAAGATGGGACAGGG - Intergenic
921582444 1:216910807-216910829 CTGTGTACATTGATAAGAATTGG + Intronic
923521084 1:234735280-234735302 CTGGGTCCAAAGTTGAGACTTGG + Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1063939620 10:11113774-11113796 CTGGCTGCACAGAGGAGACTAGG - Intronic
1063962514 10:11318768-11318790 CTGTGTACAGAGAAGGGAGTTGG + Intronic
1065129503 10:22606406-22606428 CTGTGTACACAGAAGAGCTGAGG - Intronic
1067066924 10:43109375-43109397 CTGTGTGCACAGAAGAGGCCTGG + Intronic
1067183888 10:44011021-44011043 CTGTGAGCTCAGAGGAGACTTGG + Intergenic
1068132471 10:52911842-52911864 CTTTGTAAACAGATTAGAGTTGG - Intergenic
1070567060 10:77611829-77611851 CTGTGTGCTCAGACAAGACTAGG + Intronic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1072472602 10:95726815-95726837 CAGTGTGCAGAGATGATACTGGG - Intronic
1074268665 10:111930708-111930730 CTGTTTCCCCAGAAGAGACTTGG - Intergenic
1074452104 10:113567716-113567738 CTGTGGACACTGATGAGCCCAGG + Intronic
1075192432 10:120322114-120322136 ATGTGTTCACAGAAGAGAATTGG - Intergenic
1075582142 10:123627994-123628016 CCATGTACAAAGATGAAACTTGG - Intergenic
1078132936 11:8628237-8628259 CTGAGTTCAGAAATGAGACTAGG - Intronic
1079109492 11:17596477-17596499 CAGTGCACACAGAGGAGGCTGGG + Intronic
1079593715 11:22214334-22214356 CTGGGTACACAGTTGATTCTAGG - Intronic
1080731124 11:34954363-34954385 CTGTGTACACAGATGAGATTAGG + Intronic
1093707391 12:22289319-22289341 CTGTTTCCTCAGATGAGAATTGG - Intronic
1095154764 12:38839088-38839110 CTGTGTACCCAGATTTCACTTGG + Intronic
1095903962 12:47358234-47358256 ATGTGTGTACAGATGTGACTAGG + Intergenic
1096866516 12:54567066-54567088 CCGTCTACATAGATGAGACACGG + Exonic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1098570440 12:71981894-71981916 CTGTGTAGTCATAGGAGACTTGG - Intronic
1100931507 12:99615124-99615146 GTGTTTACACAGATGACATTAGG + Intronic
1102654626 12:114471515-114471537 CTGTCTACACAGAGGTGATTTGG + Intergenic
1103738240 12:123074222-123074244 CTGTTAAATCAGATGAGACTTGG + Intronic
1105601090 13:21887809-21887831 CATTGTACAAAGTTGAGACTTGG + Intergenic
1106419278 13:29572219-29572241 CTCTGGGCACAGATGTGACTTGG - Intronic
1106673607 13:31933925-31933947 CTGGGTACACCTCTGAGACTTGG + Intergenic
1107892602 13:44927399-44927421 CTGTGTACACAGATGGGCAATGG - Intergenic
1108713435 13:53056407-53056429 CTGTGTCTACAGAGGAGCCTGGG + Intergenic
1110644029 13:77860401-77860423 ATTTGTACTCAGATAAGACTTGG - Intergenic
1111190525 13:84800876-84800898 CGGTGTACACAGAAGATATTGGG - Intergenic
1111727082 13:92025344-92025366 CTGTGTACACAGAAGTGTTTTGG - Intronic
1111910170 13:94302314-94302336 CTGTGTCCTCACATGAGACAAGG + Intronic
1112993310 13:105540953-105540975 CTGTGAAAATAGAGGAGACTTGG + Intergenic
1113907108 13:113824618-113824640 GTGTGTACACATTTGTGACTGGG + Intronic
1114765208 14:25362730-25362752 CTGTGTAGGAAGATGGGACTTGG + Intergenic
1114826559 14:26087686-26087708 CTGTTTACTGAGATGACACTGGG + Intergenic
1116023076 14:39484822-39484844 CTGTGTCCACTGATGGGACCAGG + Intergenic
1117976949 14:61308455-61308477 CTGAGTACTAAGATGAAACTTGG - Intronic
1118031221 14:61820090-61820112 CTGTGTACAAATGTAAGACTAGG + Intergenic
1119180873 14:72604629-72604651 CTGTGGACACAGATGACCCAGGG + Intergenic
1124106274 15:26740632-26740654 CTGTCTCCACAGCTGAGGCTTGG + Intronic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127935690 15:63635389-63635411 CTGTTGAGACAGATCAGACTTGG - Intronic
1129377851 15:75145406-75145428 CTGGGTCCACAGCTGTGACTTGG + Intergenic
1131985913 15:98042814-98042836 GTGTGTAGATAGATGAGAGTGGG + Intergenic
1136247095 16:28982351-28982373 ATGAGTCCAAAGATGAGACTAGG - Exonic
1137601548 16:49759824-49759846 CTGTCTGTGCAGATGAGACTAGG + Intronic
1137775893 16:51054057-51054079 CTGTCTGCACAGATAAAACTTGG + Intergenic
1137990829 16:53153320-53153342 GTTTGTATACAGATGAGAATGGG + Intronic
1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG + Intronic
1141873839 16:86807776-86807798 CTGTGTCTACAGATGTCACTAGG + Intergenic
1142258060 16:89024851-89024873 CTGTGTGCACAGGTGGGCCTCGG - Intergenic
1142404363 16:89879115-89879137 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404378 16:89879199-89879221 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404402 16:89879367-89879389 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404407 16:89879409-89879431 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404414 16:89879451-89879473 CCGTGTACACAGATGGGCTTCGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147494706 17:40904742-40904764 GTGTGTAGAGAGATGAGAATGGG + Intergenic
1147608864 17:41789696-41789718 CTGTGCAGACAGCTGAGTCTAGG - Intergenic
1148070470 17:44905816-44905838 CTGTGCCCAGAGATGGGACTGGG - Intronic
1148570001 17:48660651-48660673 CTGTTCACACAGATAAAACTAGG - Intergenic
1149096328 17:52845272-52845294 CTGTGTAACCAGATGATCCTGGG + Intergenic
1149489611 17:57074113-57074135 CTCAGTTCACAGATGAGACAAGG + Intergenic
1153828287 18:8897286-8897308 CTGGGAACACAGAGGAGACGTGG - Intergenic
1162772555 19:12958033-12958055 CTGTGTGCACAGAAGACACATGG - Intergenic
1162811236 19:13165326-13165348 CTGTGTAAACAGAGGGGACTTGG - Intergenic
1163291725 19:16383630-16383652 GTGTTTACACAGATGAGCCTGGG - Intronic
1163351574 19:16779454-16779476 CTGGACACACAGGTGAGACTTGG + Exonic
1163520821 19:17790620-17790642 CTGGGGACACAAATGAGGCTGGG + Intergenic
1163785342 19:19272299-19272321 CTGTGTACAAAGATTTGTCTTGG - Intronic
1164128615 19:22341287-22341309 CTTTGTACAAAGAGGAGACCTGG + Intergenic
1164846395 19:31436695-31436717 CTGTATGCACAGAAGAGACCAGG - Intergenic
1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG + Intronic
1166377260 19:42334450-42334472 TGGTGTTCACAGATGAGAGTGGG - Intronic
925306664 2:2851573-2851595 CTGTGTACACTCCTGAGTCTTGG - Intergenic
925677555 2:6380908-6380930 TTGTCTCCACTGATGAGACTAGG + Intergenic
929148757 2:38729496-38729518 CTCTATATAAAGATGAGACTTGG + Intronic
930188711 2:48436239-48436261 CTGTTTTCACTGAAGAGACTAGG - Intergenic
930600940 2:53442377-53442399 CTGTGGACAGAGCTGAGAATTGG + Intergenic
933832224 2:86220137-86220159 CAATCTACACAGATGAGACAAGG + Intronic
934662400 2:96150171-96150193 CTGTGTTCCCAGATGGGCCTGGG + Intergenic
936075207 2:109397425-109397447 TTGTGTACACAGAGGTGGCTGGG - Intronic
937638236 2:124181098-124181120 ATGTGAACACAGAAGAAACTTGG - Intronic
937875721 2:126823960-126823982 CTGTGGCTACAGATGAGCCTTGG + Intergenic
938282958 2:130079769-130079791 ATATGTACATAGCTGAGACTGGG + Intronic
938333591 2:130468329-130468351 ATATGTACATAGCTGAGACTGGG + Intronic
938356222 2:130652336-130652358 ATATGTACATAGCTGAGACTGGG - Intronic
938432654 2:131259137-131259159 ATATGTACATAGCTGAGACTGGG - Intronic
938972219 2:136443062-136443084 CCATATAGACAGATGAGACTAGG + Intergenic
941245330 2:163088724-163088746 CTGTCCACACAGATGAGTTTAGG + Intergenic
944781754 2:203025720-203025742 CTGTGAACTCAGAGGACACTTGG + Intronic
945180949 2:207090558-207090580 CTGTGTTCACAGAGGTTACTAGG + Intronic
948983458 2:241506903-241506925 GCGTGGTCACAGATGAGACTGGG - Intronic
1170324814 20:15145177-15145199 CTGTATTCACAGATGACATTTGG + Intronic
1171318159 20:24214158-24214180 CTGTGTACTCAGATGCACCTTGG - Intergenic
1172672549 20:36644356-36644378 CCTTGTTCACAGATGAGACGGGG - Intronic
1174509046 20:51037307-51037329 CTGCGTAAACAGCTGAGTCTTGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1176044858 20:63087325-63087347 GGGTGTACACAGATGCGTCTGGG + Intergenic
1178018479 21:28379794-28379816 CTATGTACATAAATAAGACTAGG - Intergenic
1181257902 22:21576031-21576053 CTGTGTCCAAAGATGAGCATAGG + Intronic
1181701256 22:24622769-24622791 CTGTGGCCACAGATGAGAGAAGG + Intronic
1183399646 22:37594800-37594822 CTCTGGACTCAAATGAGACTTGG + Intergenic
1184322032 22:43749287-43749309 CTGTGGACACTGGTGAGTCTGGG + Intronic
1184483110 22:44759602-44759624 CTGGGTATGCAGATGAGACCCGG - Intronic
1185173079 22:49304730-49304752 CTGCGTGCAGAGGTGAGACTGGG - Intergenic
954290707 3:49648544-49648566 TTGTGTACACAGGTGATGCTGGG + Intronic
954372381 3:50175596-50175618 CTGTGTCCACAGATGACTCATGG - Intronic
954457240 3:50606449-50606471 CTGTGTACACAACTGAAAATCGG + Intergenic
958660808 3:97064000-97064022 TTGTGGACACAGAAGAGACAAGG + Intronic
960794571 3:121471802-121471824 CTGGGTACAGAGATGAGTATTGG - Intronic
963111207 3:141689593-141689615 CTGTCTACCCAGGTGAGACAAGG + Intergenic
964445559 3:156753846-156753868 CTGAGGACACAGAATAGACTGGG + Intergenic
965222742 3:165948710-165948732 ATTTGTACAAAGATAAGACTTGG + Intergenic
965883388 3:173414006-173414028 CTGTGCACACAGAAGATCCTGGG + Intronic
966077198 3:175951573-175951595 CTGAGTAGCCAGATGAGACCAGG - Intergenic
970431618 4:15994165-15994187 CTGTGTTCACAGATTAAACAAGG - Intronic
974822057 4:67079834-67079856 CTGTCACCACAGATGAGTCTGGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978871659 4:113585366-113585388 CCGTGCACACACATGAGGCTGGG - Intronic
981611982 4:146603275-146603297 CTGTGTTCACAGAACACACTTGG + Intergenic
986254214 5:6088303-6088325 GTGTGTTCGCAGAAGAGACTGGG + Intergenic
986345111 5:6827443-6827465 CTGTGTGCACAGATTTGATTAGG - Intergenic
987063861 5:14268831-14268853 CCGTGGACACAGATGGCACTGGG - Intronic
989232170 5:39099186-39099208 CTGTGGAATCAGGTGAGACTGGG + Intergenic
991044566 5:62209555-62209577 CTATGTACTCAGAAGAGTCTGGG - Intergenic
998566661 5:143221880-143221902 CTGAGTACATAGTTGATACTGGG + Intronic
999821167 5:155230315-155230337 CTGTGTACACAGATGATTGTAGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1007229215 6:40336776-40336798 TTGTGAACACAGATGTGACTTGG + Intergenic
1008795167 6:55294169-55294191 CTGTATGCAAAGATGGGACTCGG - Intergenic
1013613334 6:111817162-111817184 CTGTGTATACAGGTGGGATTTGG + Intronic
1013626383 6:111941153-111941175 CTGTTTACAAAGATGTGAGTGGG - Intergenic
1014700825 6:124685982-124686004 CTGTGTTCTCAGCTGAGGCTTGG + Intronic
1014773172 6:125479865-125479887 ATCTGTACTTAGATGAGACTCGG + Intergenic
1014893371 6:126870034-126870056 CTGTGAATGCAGATGATACTGGG - Intergenic
1015326822 6:131932679-131932701 CAGTGTTCAGAGATGAGGCTGGG - Intergenic
1016571228 6:145515350-145515372 TTGTGAACACAGATCAGATTGGG + Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017121815 6:151031064-151031086 CTGAGTACAAAGTTGAGGCTGGG - Intronic
1017491712 6:154951189-154951211 TTGTGTACAGAGAGCAGACTGGG - Intronic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1019260303 7:78300-78322 CTGTTTACACTGATGAGCCCAGG - Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019496512 7:1342906-1342928 ATGGGGACACAGATGAGATTTGG - Intergenic
1020157614 7:5739507-5739529 CTATGTAGACAGATGAATCTGGG - Intronic
1020483573 7:8692710-8692732 TTGTGTACACAAAGGATACTGGG - Intronic
1021532184 7:21659116-21659138 TTTTGCACACAGATGACACTCGG - Intronic
1021582278 7:22169188-22169210 CTGTGTACGCAGAAGAGCCAGGG + Intronic
1025153174 7:56576635-56576657 CTGTGTTGACAGATCAGTCTGGG + Intergenic
1026432749 7:70363976-70363998 CTGTGTACACAAATAACACAAGG - Intronic
1026655931 7:72256525-72256547 CTGGATTCACAGATAAGACTTGG + Intronic
1028675899 7:93460184-93460206 TTGTGAACATAGATGATACTAGG - Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030849752 7:114468820-114468842 CTGTGTTAACTGATGAGAATTGG - Intronic
1031226313 7:119042177-119042199 TAAGGTACACAGATGAGACTCGG + Intergenic
1031985952 7:128164871-128164893 CTGTGGGCCCAGATGAGACTGGG + Intergenic
1035651650 8:1270237-1270259 CCGTATACACAGAAGGGACTTGG + Intergenic
1037411364 8:18601830-18601852 CTGCGCACACAGAAGAGACCAGG + Intronic
1037766043 8:21772931-21772953 CTGCGTGCACAGGTGACACTGGG - Intronic
1040456343 8:47601813-47601835 CTGTGTACAAAGATGAACTTTGG + Intronic
1040581684 8:48703794-48703816 CTGTGGGCACAGGTGAGACCTGG + Intergenic
1041971000 8:63742627-63742649 CTGTGTACTCAGAAGAGAGGAGG + Intergenic
1042735393 8:71982141-71982163 TTGTGTACACAAATGAGATAAGG - Intronic
1043698545 8:83252495-83252517 CTTTGTACAAAGAATAGACTAGG - Intergenic
1044496251 8:92888086-92888108 CTGTGTAACCAGATGGGTCTGGG - Intronic
1045648887 8:104324886-104324908 CTCTGTACACAGAACAGACTTGG + Intergenic
1048962984 8:139595364-139595386 CTTAGGACACAGAGGAGACTTGG - Intergenic
1049921406 9:368204-368226 CTTTGTACACTGATGAGTCCCGG - Intronic
1050697398 9:8294283-8294305 GCGTGATCACAGATGAGACTTGG + Intergenic
1051368505 9:16338544-16338566 CTGTGTACACAGATACCACACGG - Intergenic
1051443884 9:17119730-17119752 CAGAGGACAAAGATGAGACTGGG + Intergenic
1053833852 9:42112552-42112574 CTGTGGGAACAGATGAGGCTTGG + Intronic
1054596700 9:67074858-67074880 CTGTGGGAACAGATGAGGCTTGG - Intergenic
1057349674 9:94285144-94285166 CAGTGTATACAAATGATACTTGG + Intronic
1058055539 9:100444933-100444955 GTTTGTACATAGATGACACTGGG + Intronic
1193554052 X:82932134-82932156 CTGGGTTCACAGCTGTGACTTGG - Intergenic
1193608921 X:83604746-83604768 CTTTGTACACAGCTCATACTAGG + Intergenic
1198839761 X:140843823-140843845 CTGTGGCCACAAATGAGTCTTGG - Intergenic
1199004309 X:142676904-142676926 CTGTGTACACATGTGTGCCTGGG + Intergenic
1199810450 X:151343721-151343743 GTGTGTACAAAGAGGAGACATGG - Intergenic
1199997342 X:153033729-153033751 CTGTGGACATAGACCAGACTGGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic