ID: 909339468

View in Genome Browser
Species Human (GRCh38)
Location 1:74515534-74515556
Sequence ACTTGTGCCTCTTGTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909339468_909339471 -2 Left 909339468 1:74515534-74515556 CCAGTTTTACAAGAGGCACAAGT No data
Right 909339471 1:74515555-74515577 GTCTAATTAGGGCAGAAGTCAGG No data
909339468_909339472 20 Left 909339468 1:74515534-74515556 CCAGTTTTACAAGAGGCACAAGT No data
Right 909339472 1:74515577-74515599 GAAGAGATTGCAAGTAATTGAGG 0: 1
1: 0
2: 0
3: 16
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909339468 Original CRISPR ACTTGTGCCTCTTGTAAAAC TGG (reversed) Intronic
No off target data available for this crispr