ID: 909341441

View in Genome Browser
Species Human (GRCh38)
Location 1:74536004-74536026
Sequence CTGATTACTAGGAGCTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909341441 Original CRISPR CTGATTACTAGGAGCTACCA TGG (reversed) Intronic
903218073 1:21854141-21854163 CTGAGCCCTAGGAGCTCCCAAGG - Intronic
907691315 1:56669507-56669529 CTGCCTACTGGGATCTACCATGG + Intronic
909341441 1:74536004-74536026 CTGATTACTAGGAGCTACCATGG - Intronic
916004470 1:160646816-160646838 CTGATTCCTGGCAGCTAACATGG + Intronic
916273272 1:162967077-162967099 AGGATTACCTGGAGCTACCAGGG - Intergenic
1064126081 10:12661860-12661882 GTGGTTGCTAGGAGCTAACATGG + Intronic
1068783670 10:60946297-60946319 CTGATTGCTAGGAGTGAACAGGG - Intronic
1070465533 10:76719454-76719476 CAGATTACAAGGGGCTACAAAGG - Intergenic
1073184823 10:101609553-101609575 CTGTCTTCTAGGAGCTATCAAGG + Exonic
1074971277 10:118541406-118541428 CAGATGCCTAGGAGCTGCCAAGG + Intergenic
1075288281 10:121205845-121205867 CAGCTTGCTAGGAGCTGCCAGGG - Intergenic
1077975547 11:7244618-7244640 CTAATCACTAGGAGGTAGCATGG + Intronic
1080371629 11:31652973-31652995 CTTTTTACTAGCAGCTACCAAGG + Intronic
1081445738 11:43130066-43130088 CTGATTAACAGGCACTACCATGG + Intergenic
1081558888 11:44194007-44194029 CTGATTTCAAGGAGCTGCCAGGG - Intronic
1087834976 11:102864187-102864209 CTGATTACCAAGAACTTCCAAGG - Exonic
1093623466 12:21319829-21319851 GTGATCACCAGGAGCTACTATGG + Intronic
1094280440 12:28731807-28731829 ATCATTAATAAGAGCTACCAGGG + Intergenic
1094340108 12:29401598-29401620 CTGATTTCTATGACCTACCCTGG - Intergenic
1099625378 12:85066099-85066121 ATGTGTACTGGGAGCTACCAAGG + Intronic
1100864545 12:98843004-98843026 GTGATCACTAGGAGCCAACATGG + Intronic
1104380412 12:128302613-128302635 TAGATTACTATGAGCTACTAAGG + Intronic
1110941759 13:81359643-81359665 ATGACTACTAGAAGCTGCCAAGG - Intergenic
1113411417 13:110093725-110093747 CTGAGCACTGGGAGCTTCCATGG - Intergenic
1115964259 14:38869284-38869306 CTGATTATCAGGAGCCACCTGGG - Intergenic
1116891132 14:50269641-50269663 CTGTTTATTAGGACCTAGCAGGG + Intronic
1119557407 14:75564300-75564322 CTGATTCCTAAGAGCTGCAAAGG - Intergenic
1120599374 14:86482188-86482210 CTGATTACAGGCAGTTACCAAGG - Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1126420331 15:48465665-48465687 ATGAGTGCCAGGAGCTACCAGGG - Exonic
1128623343 15:69172328-69172350 CTGATCACTAGGAGCCAGCATGG + Intronic
1132710394 16:1263727-1263749 CTGGTTACTAGGTGCTTCCTTGG - Intergenic
1138477608 16:57281364-57281386 CTGATAGATGGGAGCTACCATGG + Intronic
1140335727 16:74103404-74103426 CTAATTACTAGGATCTACCTTGG + Intergenic
1146152740 17:30489874-30489896 CAGAGTACTAGGAGGTACAAAGG + Intronic
1146639244 17:34527608-34527630 CTGCTTTCTAGGAGCTTACAGGG + Intergenic
1147169911 17:38611936-38611958 ATGGTTACTAGGTGCTAGCAGGG - Intergenic
1150163759 17:62921819-62921841 CTGAGTACTAAGAGCAACGAAGG + Intergenic
1150514302 17:65791401-65791423 CTGATTATCAGAAGCAACCAGGG - Intronic
1150671715 17:67206260-67206282 CTGTTCACTAGGAGTTACAAAGG + Intronic
1150806114 17:68320466-68320488 CTGATTCCTAGGATCTCCCTCGG + Intronic
1153255568 18:3166994-3167016 CTGTTAGCTAGGAGCTAGCATGG + Intronic
1153390045 18:4546025-4546047 CTAAGTACTAGGAACTACAAGGG - Intergenic
1153536091 18:6102990-6103012 ATGATTACTAGAAACTTCCAAGG + Intronic
1158919474 18:62174272-62174294 CAGTGAACTAGGAGCTACCATGG - Intronic
1160637545 19:91007-91029 CTGACTACTGGGCGCTACCTGGG + Intergenic
1163120197 19:15212828-15212850 CTCATCACTAGGAGCAACCAAGG + Intergenic
1166714420 19:44957505-44957527 CTGATTACCTGGATCCACCACGG - Intronic
928402893 2:30992122-30992144 CTGCTTACTAGGTCTTACCAGGG + Intronic
931388062 2:61815095-61815117 CAGATGACTAGGAGCAACCTTGG + Intergenic
933255805 2:80079413-80079435 GTGCTTAGTAGGAGCTCCCATGG - Intronic
942745690 2:179229385-179229407 CTGAGGACTAGGAGCAACAATGG - Intronic
943496394 2:188626425-188626447 AGGATTACTAGGGGCTAGCAAGG + Intergenic
948137677 2:235648972-235648994 CCAATTAGGAGGAGCTACCATGG - Intronic
1170047266 20:12098492-12098514 ATTATTAGTAGGAACTACCAGGG - Intergenic
1178548788 21:33517266-33517288 CTGATTACTTAGAGCTAAAAGGG - Intronic
1181367695 22:22391319-22391341 CTGAATACTCGGAGCTCTCAGGG - Intergenic
1182698446 22:32211921-32211943 CTGATTGCTTGGTGATACCATGG - Intergenic
956947498 3:74239607-74239629 CTTATTACCAGTAGCTACAATGG - Intergenic
960197522 3:114787797-114787819 CTTATTAGTAGGAGAAACCATGG - Intronic
963296698 3:143554573-143554595 GTTATTGCTAGGGGCTACCATGG - Intronic
964025831 3:152072906-152072928 CTGGTTATTGGGAGCTAACATGG - Intergenic
965408600 3:168301902-168301924 CTGATTCCTTCCAGCTACCAGGG - Intergenic
977858897 4:101931461-101931483 CTGAGAACTAGGAGATCCCATGG - Intronic
980184416 4:129444318-129444340 GTAATTACTAGCAGCTACAATGG - Intergenic
980271583 4:130591053-130591075 CTGGTTTCTATGACCTACCATGG - Intergenic
984043156 4:174762865-174762887 CTGATTGTGAGGAGGTACCACGG - Intronic
985231023 4:187817685-187817707 GTGATTACCAGAGGCTACCAAGG - Intergenic
985891527 5:2719412-2719434 CTGATTTCTAAGAGCTTCGATGG - Intergenic
986580891 5:9264699-9264721 CTGGTTGCCAGGATCTACCAAGG - Intronic
987369523 5:17180426-17180448 GTGGTTATTAGGAGCTACCACGG + Intronic
990981201 5:61603837-61603859 GTGACTGCTAGGAGCCACCACGG + Intergenic
991946514 5:71903023-71903045 CTGATTTTTAGGAGGTCCCATGG - Intergenic
999682429 5:154072665-154072687 CTGATCTCTAGGAGCCAACAGGG - Intronic
1001934908 5:175696924-175696946 CTGAGCCCTAAGAGCTACCACGG - Intergenic
1002615677 5:180454208-180454230 CTGGTTTCTAGAAGCTACTATGG + Intergenic
1012204996 6:96450424-96450446 CTTATTACTAGTAGCTAGGAGGG - Intergenic
1014686739 6:124511027-124511049 CTGATAACTATGTGCTACCCAGG + Intronic
1018102973 6:160457606-160457628 ATTATTAGTAGGAGCTGCCATGG + Intergenic
1020104008 7:5412783-5412805 GGGATTACCAGGAGCTTCCAGGG + Intronic
1020520492 7:9179981-9180003 GTGATTAGTAGGAGCTACTCAGG - Intergenic
1022253525 7:28632238-28632260 CTGATTTCTAGCAGCTACCAAGG + Intronic
1027723419 7:81771970-81771992 CTGGTTTCTAGGAGCCACCTTGG - Intergenic
1030505361 7:110415538-110415560 TTGATTACTAGCAGCTGCCCAGG + Intergenic
1034995565 7:155575153-155575175 CTCATTAGTATAAGCTACCAGGG - Intergenic
1043237608 8:77888227-77888249 CTCACTATTAGGAGATACCAAGG + Intergenic
1044694256 8:94906704-94906726 TTCATTACTAGGAACCACCAAGG - Intronic
1045317514 8:101056166-101056188 CTGAGTACTGGGAGTTACCAAGG + Intergenic
1057082079 9:92180629-92180651 CTGCGTACTCGGAGCTCCCAAGG - Intergenic
1059948258 9:119435249-119435271 CTGATTGCTACAGGCTACCAGGG + Intergenic
1060688379 9:125633016-125633038 GTGATTGCTAGGAGCCACCATGG - Intronic
1061798245 9:133100880-133100902 CTCATTGCCAGGAGCTAGCATGG - Intronic
1186693921 X:12008601-12008623 CTTATTTCATGGAGCTACCATGG - Intergenic
1187430080 X:19214580-19214602 CTGATGACTAAGAGCAAGCAGGG - Intergenic
1190437159 X:50437058-50437080 TTTATTACTAGGAGCTATCCAGG - Intronic
1193992892 X:88330368-88330390 ATGAATACTAGGAGCTATTACGG + Intergenic
1194202387 X:90969579-90969601 ATGATTACTAGAAGCTATGAAGG + Intergenic
1199914485 X:152324341-152324363 ATTATTAGCAGGAGCTACCATGG + Intronic
1200548224 Y:4545033-4545055 ATGATTACTAGAAGCTATGAAGG + Intergenic