ID: 909344887

View in Genome Browser
Species Human (GRCh38)
Location 1:74573169-74573191
Sequence AGGGAGCAGCAGAAGCAGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1053
Summary {0: 1, 1: 0, 2: 12, 3: 93, 4: 947}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909344887_909344894 3 Left 909344887 1:74573169-74573191 CCCTTCTGCTTCTGCTGCTCCCT 0: 1
1: 0
2: 12
3: 93
4: 947
Right 909344894 1:74573195-74573217 CCCCCCTTTCTATGCCTGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 133
909344887_909344892 2 Left 909344887 1:74573169-74573191 CCCTTCTGCTTCTGCTGCTCCCT 0: 1
1: 0
2: 12
3: 93
4: 947
Right 909344892 1:74573194-74573216 GCCCCCCTTTCTATGCCTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 136
909344887_909344891 -1 Left 909344887 1:74573169-74573191 CCCTTCTGCTTCTGCTGCTCCCT 0: 1
1: 0
2: 12
3: 93
4: 947
Right 909344891 1:74573191-74573213 TCTGCCCCCCTTTCTATGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909344887 Original CRISPR AGGGAGCAGCAGAAGCAGAA GGG (reversed) Exonic
900289067 1:1916169-1916191 AGGGAACAGCAGCAGCTGCAGGG - Intronic
900539871 1:3197280-3197302 TGGGAGCTGCAGGGGCAGAAAGG - Intronic
900750835 1:4396269-4396291 AGGCAGCAGGTGCAGCAGAAAGG + Intergenic
901082549 1:6591739-6591761 AGGGAGCAGAGGAAGGAGAAGGG + Exonic
901501666 1:9656154-9656176 GGGGAGGAGGAGATGCAGAAAGG + Intronic
901683541 1:10930278-10930300 GGGCGGCAGCAGCAGCAGAAGGG + Intergenic
902594121 1:17496355-17496377 AGAAAACAGCAGAAGCAGATGGG + Intergenic
902620817 1:17649868-17649890 AGGGTGCAGCAGAAACAGTGGGG + Intronic
902665646 1:17935796-17935818 AGGGAGGGACAGAAGAAGAAAGG - Intergenic
902783922 1:18721025-18721047 CGGGAGCAGCAGCAGCAGGCAGG + Intronic
902975143 1:20083097-20083119 AGGGAGCAGCAGAGAAAGATTGG + Intronic
903384884 1:22919695-22919717 AGGGAGCAGGAGAGGGAGGAGGG + Intergenic
903575795 1:24339019-24339041 ATGAAGCAGCAGCAGCAGTATGG - Intronic
903741754 1:25562518-25562540 ATGGAGCTGCAGAAGCTGCAGGG + Intronic
903788183 1:25875197-25875219 TGGGAGGAGCAGAAGGAGCACGG - Intergenic
904347496 1:29882827-29882849 GGGGAGCAGCAGATGCCCAATGG - Intergenic
904396639 1:30226947-30226969 AGGGAGTACCCGAAGCAGAGAGG + Intergenic
904671867 1:32171972-32171994 AGGAAGAAGAAGAAGAAGAAAGG - Exonic
904852325 1:33468385-33468407 GGAGACCAGCAGAAGCAGCAGGG - Intergenic
904993365 1:34612015-34612037 AGGGACCTGGAGGAGCAGAACGG + Intergenic
905014332 1:34766888-34766910 AGGTAGCAGCTGGAGAAGAATGG - Intronic
905359152 1:37406582-37406604 AGAGAGCAGCAGATGCACACAGG + Intergenic
905905313 1:41614161-41614183 GGTCAGCAGCAGAATCAGAATGG + Intronic
906456503 1:46001778-46001800 AGGGAGAAGAAGAAGCAAAAAGG - Intronic
906529105 1:46512978-46513000 AGAGAGAAGGAGAAACAGAAGGG - Exonic
906730819 1:48079628-48079650 AGAGAGGAGCAGCAGCACAAAGG + Intergenic
906814731 1:48867154-48867176 AGGGAAAAGCAAAGGCAGAAGGG + Intronic
907573539 1:55505764-55505786 AGGGAGGAGGAGAGGAAGAATGG - Intergenic
907971641 1:59388503-59388525 AGGCAGCAGCAGGAGAAGAAGGG + Intronic
908275905 1:62470908-62470930 AGGTAGCAGGGGAGGCAGAAGGG - Intronic
908340545 1:63173941-63173963 AGAAAACAGCAGAAGCAGGAGGG + Intergenic
908844124 1:68307190-68307212 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
908909020 1:69050940-69050962 TTGGAGCACCAGAAGCAAAAGGG - Intergenic
909116319 1:71541644-71541666 ATGGAACAGCAGGAACAGAACGG + Intronic
909292754 1:73904548-73904570 AGGGAGCAGGAGAGGAAGGAGGG + Intergenic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
909829070 1:80162590-80162612 AGGAAACAGCAGAAGGAGGATGG + Intergenic
910275697 1:85446817-85446839 AGAGAGAAGGAGAAGAAGAAAGG - Intronic
910514014 1:88037573-88037595 TGGCAGCAGCAGTGGCAGAAGGG - Intergenic
910783962 1:90973905-90973927 AGAAAACAGCAGAAGCAGGAAGG + Intronic
910797964 1:91117575-91117597 AGAAAACAGCAGAAGCAGAAGGG + Intergenic
910806184 1:91191632-91191654 AAGGAACAGCAAAAGGAGAAAGG - Intergenic
911054423 1:93698121-93698143 AGGCAGCAGCGGAAGCAGGATGG + Intronic
911117961 1:94265700-94265722 GGGGAGCAGAAGCAGTAGAAAGG - Intronic
911313091 1:96320971-96320993 AGAGAGCAAAAGAAGAAGAATGG + Intergenic
911647697 1:100353188-100353210 AGGGAGCTGCAGAGGGAGCAAGG - Intronic
911732853 1:101308234-101308256 AGGAAACAGCAGAAGCAGGAAGG + Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
912182984 1:107240525-107240547 AGGGCACTGCACAAGCAGAATGG - Intronic
912364052 1:109118414-109118436 AGATAGCAGCCTAAGCAGAATGG + Intronic
912469688 1:109898027-109898049 AGGGAGCAGCAAAAGCAAAGTGG - Intergenic
912470138 1:109901167-109901189 AGGGAGCAGCAAAGGCAAAGTGG - Intergenic
912735202 1:112144206-112144228 AGGAACCAGCAGAACCAGAATGG - Intergenic
913245910 1:116869756-116869778 GGGGAGGAGGAGAAGAAGAAAGG + Intergenic
913540906 1:119819996-119820018 AGGGAGAAAGAGAAGAAGAAGGG - Intergenic
914698355 1:150107019-150107041 AGGTAGGAGGAGAATCAGAAGGG - Intronic
914753477 1:150550524-150550546 AGAGAGAAGCAGAGGCAGAGAGG + Intronic
914925986 1:151888125-151888147 AGGGAGTGGGAGAAGCAGGACGG - Intronic
915191870 1:154157604-154157626 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
915388470 1:155518778-155518800 AGGGAGCAGGAGAGGTAGAGGGG + Intronic
915571805 1:156748960-156748982 AGGAAGCAGCAAAAGCAGAAAGG + Intronic
916138737 1:161675418-161675440 AGGGAGCAGCAGTGGGAGGATGG + Intronic
916456104 1:164972443-164972465 AGGCAGCAGCAGAGGCAGAAGGG - Intergenic
916616257 1:166444168-166444190 AGAGAGAAGGAGAAGGAGAAAGG + Intergenic
916616266 1:166444252-166444274 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
916654118 1:166858259-166858281 AGGGAGCAGTAAAAGCTGGAGGG + Exonic
917256175 1:173118741-173118763 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
917521429 1:175751127-175751149 AGGGAGGAGCAGAACCAGGCTGG - Intergenic
917731281 1:177877324-177877346 GGGGAGCAGCACAAGCACATAGG - Intergenic
917845239 1:179014981-179015003 AGGGATCAGGAAAAGCAGCAAGG - Intergenic
917867271 1:179209085-179209107 AGGAAACAGCAGAAGCAAAGAGG + Intronic
917958593 1:180125167-180125189 AGGTGTGAGCAGAAGCAGAAAGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919267303 1:195286342-195286364 AGGAAGAAGAAGAAGAAGAAGGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919535545 1:198783122-198783144 AGGGAGAGGAAGCAGCAGAAGGG + Intergenic
919893845 1:201996115-201996137 AGAGAGCAGAGAAAGCAGAATGG - Intronic
919976285 1:202615176-202615198 ATGAAGCAGCAGCAGCAGATTGG + Intronic
920063264 1:203244057-203244079 AGGTAGAAGGAGAAGAAGAAGGG + Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920113798 1:203605370-203605392 GGAGGACAGCAGAAGCAGAAAGG - Intergenic
920160838 1:203996665-203996687 TGGGAGAAGGAGAAGCAGGATGG + Intergenic
920341607 1:205278656-205278678 AGGAAGCATAAGAAGCAAAAAGG + Intergenic
920442401 1:205989681-205989703 AGGGACCAGGGGAGGCAGAAGGG - Intronic
920521254 1:206628700-206628722 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
921219230 1:212961468-212961490 AGGGAGAAAGAGAAGCAGAAGGG - Intronic
921397055 1:214679620-214679642 AAGGAGAAGAAGAAGAAGAATGG - Intergenic
922034974 1:221839374-221839396 AGAAAACAGCAGAAGCAGTAAGG - Intergenic
922722751 1:227906882-227906904 AGGGAGAAGCAGAAGGGAAAGGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923107335 1:230864897-230864919 AGGAAACAGCAGAAGCAAACAGG + Intronic
923227858 1:231955962-231955984 AGAAAACAGCAGAAGCAGAAAGG + Intronic
923318578 1:232805793-232805815 AGGGGGCAGCTGCAGCAGCAAGG - Exonic
923378296 1:233388914-233388936 TGGGAGTAGCAGAAGAAGAGAGG - Intergenic
923380432 1:233411917-233411939 AGGGAACTGCAGAAGCAGGAAGG + Intergenic
923760018 1:236833595-236833617 AGGGGGCAGTAGAAACAGGAAGG + Intronic
924566880 1:245206176-245206198 AGGGAGCTGGAGAATAAGAAGGG - Intronic
924635953 1:245788062-245788084 AGGGAACAGCGCAAGGAGAATGG + Intronic
924705686 1:246500074-246500096 AAGGAGCAGCAGCAGCAGCAGGG - Intronic
1062962172 10:1580743-1580765 AGGGAGGAACAGAAGGAGCATGG - Intronic
1062970504 10:1644458-1644480 AGGGAGAAGGAGAAGGACAAAGG + Intronic
1063015488 10:2072626-2072648 ACGGAGCAACACAACCAGAATGG - Intergenic
1063057218 10:2518958-2518980 AGGAAGAAGAAGAAGAAGAAGGG + Intergenic
1063071373 10:2669810-2669832 AGGAAGAAGAAGAAGAAGAAGGG + Intergenic
1063216284 10:3928970-3928992 TGGGACCAGGAGAAGGAGAAAGG + Intergenic
1063252229 10:4286232-4286254 AGGAAGAGGCAGATGCAGAAAGG - Intergenic
1064138995 10:12774428-12774450 AGGGAGCAGGGGAAGCAGGAAGG + Intronic
1064834998 10:19516759-19516781 AGGGAGGAGAAGAAGGTGAAGGG - Intronic
1065173843 10:23057898-23057920 AGGAAACAGCAGAAGCAGGAAGG - Intergenic
1065174299 10:23061979-23062001 AGTAAACAGCAGAAGCAGGAAGG - Intergenic
1065286510 10:24192406-24192428 AGAAAACAGCAGAAGCAGGAAGG - Intronic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065516127 10:26526052-26526074 AGAAAACAGCAGAAGCAGGAAGG - Intronic
1065927273 10:30446033-30446055 AGGCAGCAGCAGCCGCTGAAGGG - Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066638535 10:37532312-37532334 AGGACACAGCAGAAGCAGGAAGG - Intergenic
1067410546 10:46060598-46060620 AGGTGGCAGCAGCAGAAGAAGGG - Intergenic
1068299186 10:55116737-55116759 AAGAAACAGCAGAAGCAGGAAGG + Intronic
1068911212 10:62380290-62380312 AAGGAGGAGGAGAAACAGAAGGG - Intronic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1069040156 10:63687444-63687466 AGGAAACAGCAGAAGCAGGAAGG - Intergenic
1069109988 10:64435367-64435389 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1069420829 10:68245006-68245028 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1069546196 10:69330598-69330620 AGAAAACAGCAGAAGCAGGAAGG + Intronic
1069634988 10:69919663-69919685 AGGGAGACCCAGGAGCAGAAGGG + Intronic
1069781102 10:70956244-70956266 AGGAGCCAGCAGCAGCAGAAGGG - Intergenic
1070267983 10:74923221-74923243 AAGGAGTAGGAGAAGTAGAAGGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070705452 10:78634557-78634579 AGGGAGCAGGCTAAGCAGATGGG - Intergenic
1072201265 10:93161062-93161084 AGGAACCAGCAGTAGCAGACAGG - Intergenic
1072850087 10:98880989-98881011 AGAGAGCAGCAACAGCAGCAGGG - Intronic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073385329 10:103122603-103122625 AGAAAACAGCAGAAGCAGGAAGG + Intronic
1074874032 10:117600641-117600663 AGGGAGGAGGAGAAGGAGAAGGG - Intergenic
1075017198 10:118918618-118918640 AGGTAGCAGCAGTGACAGAAGGG + Intergenic
1075197978 10:120377779-120377801 AGAGAGGAGCAGAAGGGGAAGGG - Intergenic
1075549958 10:123384887-123384909 AGGGTGCAGCAGAGCCAGACTGG - Intergenic
1075634089 10:124018634-124018656 AGAAAACAGCAGAAGCAGAAAGG - Intronic
1075646794 10:124102224-124102246 AGAGAGCACCAGAAGCAGCCAGG + Intergenic
1075689918 10:124387788-124387810 AGGAAACAGCAGAAACAGAAAGG + Intergenic
1075985745 10:126783694-126783716 AGGGAGCAGCTGGGGAAGAAGGG - Intergenic
1076059018 10:127398817-127398839 AGGGAACAGCAGCAGATGAAAGG - Intronic
1076546897 10:131251341-131251363 AGGAAGCAGCAGAGGGAGAGGGG - Intronic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076693441 10:132235628-132235650 CGTGGGCAGCAGAAGCAGACAGG + Intronic
1076719771 10:132387975-132387997 AGAGAGCAGCAGCCGCAGCAGGG + Intergenic
1076758402 10:132587362-132587384 TGGCAGCAGCAGAAGCAGGCTGG - Intronic
1076984011 11:222585-222607 TGGGAGCAGCAGACCCAGCAGGG - Intronic
1077230529 11:1456474-1456496 GGGGAGGCGCAGAAGGAGAACGG + Exonic
1077370016 11:2177448-2177470 GGGCAGCAGCAGTAGCAGAAGGG - Intergenic
1077532463 11:3103651-3103673 AGGGGGCAACAGAGGCAGGAAGG - Intronic
1077538213 11:3134516-3134538 AGGGACCAGCAGCAGGAGGAGGG - Intronic
1077563570 11:3281736-3281758 AGGGAGGAGGAGAATCAGAGAGG - Intergenic
1077569460 11:3327551-3327573 AGGGAGGAGGAGAATCAGAGAGG - Intergenic
1077615457 11:3670703-3670725 AGGAGGCAGCAGAGGGAGAAGGG - Intronic
1078027271 11:7709060-7709082 AGGGAGAATGAGAAGCAGACAGG - Intergenic
1078369776 11:10735283-10735305 TGGTAGCAGCAGAGTCAGAATGG - Intergenic
1079051313 11:17162743-17162765 AGGCAGCCCCTGAAGCAGAATGG - Intronic
1079956959 11:26878176-26878198 AGGGAGCAAGAGAAGGAAAAGGG + Intergenic
1080394313 11:31875902-31875924 AGGAAGCTGCAGAAGGAGGAGGG - Intronic
1080453690 11:32399687-32399709 ATGGAGCAGTAAAGGCAGAAAGG + Intronic
1081035660 11:38142160-38142182 AAAGAACAGCAGTAGCAGAAAGG + Intergenic
1081199614 11:40200443-40200465 AGAAAACACCAGAAGCAGAAAGG + Intronic
1081212733 11:40355891-40355913 AGGGAGGAGATGAAGCAAAATGG - Intronic
1081409832 11:42744878-42744900 AGAGAGCTGCATAGGCAGAAAGG + Intergenic
1081465804 11:43315728-43315750 AAGGAGTAGCAGAGGCAGAGTGG - Intronic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1081702376 11:45159888-45159910 TGGGGGCTGCAGAAACAGAATGG + Intronic
1081868452 11:46372356-46372378 TGGGAGCAGCAGAGGGAGAGGGG - Intronic
1081908875 11:46687346-46687368 GGGCAGCCGCAGAAGGAGAAGGG - Intronic
1082176511 11:49066254-49066276 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1082828524 11:57598296-57598318 AGCCAGCAGCAGCAGCAGGAGGG - Exonic
1083054087 11:59803091-59803113 AGAGAGCAACAGAAGGAAAAAGG - Intergenic
1084890979 11:72237135-72237157 AGGGAGCTCCTGAACCAGAAGGG + Exonic
1085300696 11:75456688-75456710 AGGCAGCAGCAGCAGAGGAAGGG - Intronic
1085514316 11:77103473-77103495 AGGGAGAAGCAGAGGAGGAAAGG - Intronic
1085666312 11:78417940-78417962 GGGGAGCAGCTGCAGCAGGAAGG + Intronic
1085855117 11:80167565-80167587 AGAGAGCACCAGAGGAAGAAAGG - Intergenic
1086597256 11:88587598-88587620 AGAAAACAGCAGAAGCAGGAAGG + Intronic
1086689202 11:89769621-89769643 CAGGAGCAGCAGAAGCTGTAAGG + Intergenic
1086716656 11:90070350-90070372 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1086867975 11:92003252-92003274 AGAGAGAAGCAGAAGCAGAGAGG + Intergenic
1087539186 11:99493059-99493081 AGGTAGCAGTAGAAGCAGGAAGG - Intronic
1087702335 11:101449474-101449496 AAGAAACAGCAGAAGCAGGAAGG + Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088442123 11:109882417-109882439 AGGGTGGAGTAGAACCAGAAGGG - Intergenic
1088610694 11:111573380-111573402 AGGGAGCAGCAGATACACATAGG - Intergenic
1088919788 11:114252491-114252513 AGGGAGGAAGAGCAGCAGAATGG - Intergenic
1089128323 11:116192977-116192999 AGGCAGCAGCCGCAGCTGAAAGG + Intergenic
1089162300 11:116447978-116448000 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1089214565 11:116827791-116827813 AGGCCGCAGCAGAAGAGGAAAGG + Intergenic
1089460875 11:118652759-118652781 AGAGACCAGCAGAGGGAGAAGGG + Intronic
1089664338 11:120008404-120008426 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1089788082 11:120922394-120922416 AGGGAGCAAAAGCAGCAGGATGG - Intronic
1089804998 11:121078739-121078761 CTAGAGCAGCAGAAGCAGTAAGG - Intronic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090208170 11:124897050-124897072 AGGGGGCTGTAGCAGCAGAAGGG + Exonic
1090713069 11:129405328-129405350 AGGAGGCAGCGGTAGCAGAAAGG - Intronic
1091111353 11:132971930-132971952 CGGCAGCAGCAGTAGCAGCAGGG - Intronic
1091398495 12:169012-169034 GGGGAGCTGGAGAAGCAGCAGGG + Exonic
1091626995 12:2128988-2129010 AGGAGGCAGCTGTAGCAGAATGG - Intronic
1091799234 12:3314262-3314284 AGGGAGCAAGACAAGCAGAGAGG - Intergenic
1091941475 12:4487510-4487532 AGATAGGAGCAGAAGCAGAATGG - Intergenic
1093084554 12:14852403-14852425 TGGGAGAAGGAGAAGGAGAAGGG - Intronic
1094175415 12:27536470-27536492 AGGGAGCAAGAGAGACAGAAGGG + Intronic
1094203499 12:27816793-27816815 AGGCAGCAGTAGAATTAGAAAGG + Intergenic
1094232910 12:28128386-28128408 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1095223253 12:39645167-39645189 AGAAAACAGCAGAAGCAGGAAGG - Intronic
1095342991 12:41114207-41114229 AGGGAGAAGGATAAGAAGAAAGG + Intergenic
1095812305 12:46383665-46383687 AGGGAGGAGGGGAAGCAGAGGGG + Intergenic
1096053742 12:48633591-48633613 AGGCAGCTGCAGGAGCAGCAAGG - Intergenic
1096187950 12:49595396-49595418 AAGGAGCAGGAAAACCAGAAGGG + Intronic
1097098261 12:56567465-56567487 AGGAAGAAGAAGAAGAAGAAAGG + Intronic
1097195122 12:57238856-57238878 AGGGACCAGAAGCAGGAGAAGGG - Intronic
1097391155 12:59015195-59015217 AGGGAGCCGCAAAAGCACAGTGG + Intergenic
1097938512 12:65278955-65278977 GGGGCGCAGCAGGCGCAGAATGG - Intronic
1099473296 12:83076773-83076795 AGGGAGAATTAGAAGCAGGAGGG - Intronic
1099883933 12:88503645-88503667 AGGGAGCAGAGAAAGCAGACGGG + Intronic
1100182688 12:92102448-92102470 ATGGAGCAGCAGAAGTGCAAGGG + Intronic
1100281309 12:93120795-93120817 AGGGAGGAGGGGAAGAAGAAGGG - Intergenic
1100415543 12:94369884-94369906 AAGCAGCAGCAGCAGCAGCAAGG + Intronic
1100542999 12:95575676-95575698 GGGGAGGAGCAGCATCAGAAAGG + Intergenic
1100717724 12:97323465-97323487 AGAGAACTGCAGAAGCAGGAAGG - Intergenic
1100891585 12:99131985-99132007 GGGGAGGAGCAGAAGAAGAGAGG - Intronic
1101008890 12:100429942-100429964 AGAGAGCAGAAGAAAGAGAAGGG - Intergenic
1102487155 12:113266289-113266311 GGAGAGCAGCAGCAGCAGCAGGG - Exonic
1102658258 12:114501926-114501948 GGGGAGCAGGAGAAGGAGAAAGG + Intergenic
1103022466 12:117547214-117547236 AGGGACTAACAGAAGCTGAATGG - Intronic
1103445547 12:120992864-120992886 GGGGCGCAGCAGCAGCAGCAGGG - Intronic
1103721946 12:122979901-122979923 TGGAAGTGGCAGAAGCAGAATGG - Exonic
1103722389 12:122981762-122981784 AGGAAGAAGCTGAAGAAGAAGGG + Exonic
1103870739 12:124089752-124089774 AGTGAGCACTAGAAGCTGAAGGG - Intronic
1103940840 12:124500393-124500415 AGGCAGCAGCAGAAGCCAAGTGG + Intronic
1104443453 12:128814147-128814169 AGGAAGGTGCAGTAGCAGAATGG - Intronic
1105040923 12:132960583-132960605 AAAGAGATGCAGAAGCAGAAGGG - Intergenic
1105704830 13:22962356-22962378 TGGGAGCAGCAGGGGCAGAGAGG + Intergenic
1105857791 13:24387514-24387536 TGGGAGCAGCAGGGGCAGAGAGG + Intergenic
1105884852 13:24632997-24633019 TGGGAACAGCAGAGGCTGAAGGG + Intergenic
1106112979 13:26793064-26793086 AGGAAACAGCAGAAGCAGGAGGG + Intergenic
1106205264 13:27587297-27587319 AAAGGGCAGCAGGAGCAGAAGGG - Intronic
1106255613 13:28019772-28019794 AGGGAGGACCAGAAGCGGGAGGG - Intronic
1106388902 13:29316364-29316386 AGGAAGCATCAGAGGTAGAAAGG + Intronic
1106682384 13:32021696-32021718 AAGGGGTAGCAGAAGCATAAGGG - Intergenic
1106785676 13:33106099-33106121 AGGGAGCAGCAAAAGGGGACAGG + Intronic
1107027719 13:35820576-35820598 ACTGAGCAGCAAAAGCAAAAAGG + Intronic
1107405221 13:40105964-40105986 AGGGGGCTGGAGAAGCAGAAAGG + Intergenic
1107518171 13:41152250-41152272 AGGGAACTGCGGAAGGAGAATGG + Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107826439 13:44332727-44332749 AGGCAGCAGCAGCAGCAGGGAGG - Intergenic
1109219261 13:59624995-59625017 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1109485083 13:63008105-63008127 AGGGGGCAGAAGATGAAGAAAGG + Intergenic
1110156260 13:72320522-72320544 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1110198409 13:72818336-72818358 AGGTAGCAGCTGAAGTGGAAAGG - Intronic
1110295196 13:73856118-73856140 AGACAGCAGCATAAGCAAAATGG + Intronic
1110601117 13:77375192-77375214 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1110621726 13:77603657-77603679 AGGCAGCAGCAGAATCTAAAAGG - Intronic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1110661296 13:78061466-78061488 AGGTAGAAGAAGCAGCAGAAAGG - Intergenic
1110703731 13:78580286-78580308 AGGCAGCATCACAAGCAAAATGG + Intergenic
1110849030 13:80223305-80223327 AGAAAACTGCAGAAGCAGAAAGG + Intergenic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112115848 13:96352502-96352524 ACGGCGCAGTGGAAGCAGAAGGG + Intronic
1112133524 13:96550293-96550315 AGGGAGCAGGAGAGAAAGAAGGG - Intronic
1112376134 13:98843052-98843074 AGGGAGCAGCAGAGGCCCATGGG - Intronic
1112440478 13:99421326-99421348 TGGGAGCAGCACAAGCAGTGTGG + Intergenic
1112488647 13:99842375-99842397 AGAAAACAGCAGAAGCAGGAAGG - Intronic
1112714708 13:102170315-102170337 AGGGAGAAGAAGAGGCAAAAAGG - Intronic
1113110175 13:106814287-106814309 AAGGAGCAGGAGAAGGGGAAGGG + Intergenic
1113114484 13:106860819-106860841 AGAAAACAGCAGTAGCAGAAGGG + Intergenic
1113325398 13:109276746-109276768 AGGAGACAGCAGAAGCAGGAAGG + Intergenic
1113526412 13:110981421-110981443 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1114192458 14:20450423-20450445 AGTGGATAGCAGAAGCAGAAAGG - Intronic
1114615763 14:24067536-24067558 AGAGAGGGGCAGATGCAGAATGG - Intronic
1114713446 14:24801657-24801679 TGGAAGCAGCAGGAGGAGAAGGG + Intergenic
1114739215 14:25077794-25077816 AGGGAGCTGGAGAAACAGATTGG - Intergenic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1117033700 14:51704629-51704651 AGGGAGGAGCAGAAACAGAAGGG + Intronic
1117134652 14:52722289-52722311 AGGGGGCAGAAGAAGTAGAAGGG + Intronic
1117236217 14:53779616-53779638 AGTGGTCAGCAGAAGGAGAATGG + Intergenic
1117506725 14:56411757-56411779 AAGGAGAAGAAGAAGAAGAACGG + Intergenic
1118033384 14:61839921-61839943 GGGGAGCAGAAGAGGAAGAAGGG + Intergenic
1118501242 14:66364594-66364616 AGGGAACACCAGTAGAAGAAGGG - Intergenic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119357415 14:74018936-74018958 CGGGAGCGGCAGAAGCGGAGCGG + Intronic
1119536771 14:75409213-75409235 AGGTTTCAGGAGAAGCAGAAAGG - Intergenic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119649329 14:76372529-76372551 AGGGAGTAGGAAAAGCAGAGTGG + Intronic
1119757814 14:77131084-77131106 AGGGAGGAGCAGGGGCAGAAGGG + Intronic
1119781508 14:77279280-77279302 AGAGAGCTGCAGAGGCAAAAGGG + Intronic
1119907171 14:78316431-78316453 AGGGAGCTGGAGATGCAGGAAGG + Intronic
1120039890 14:79740279-79740301 ATGGAGCAGCTAAAGCAGAGTGG - Intronic
1120387399 14:83863593-83863615 AGGAAGCATCATAAGGAGAATGG - Intergenic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121643091 14:95499444-95499466 AGGGACCAGCAGGAGCAAAGGGG - Intergenic
1121697988 14:95928441-95928463 AGGGAGAGGCAGAGGCAGAGAGG - Intergenic
1122132031 14:99609802-99609824 AGGGTGCAGCTGAAGCCCAAAGG + Intergenic
1122156114 14:99751380-99751402 AGGCAGCAGCAGCTGCTGAATGG + Intronic
1122204383 14:100141369-100141391 AGGGAGCAGCCACGGCAGAAAGG + Intronic
1122265888 14:100546642-100546664 AGCGCGCTGCAGGAGCAGAAGGG - Exonic
1122271876 14:100571941-100571963 AGGGAGATGCAGCGGCAGAATGG - Intronic
1122387547 14:101359330-101359352 AGGGATCAGGAGGAGCAGCAGGG + Intergenic
1122626936 14:103089680-103089702 AGGGGGCTGCAGAAACATAAAGG - Intergenic
1122773855 14:104108652-104108674 AAGGAGGAGCAGAGGCACAAAGG - Intronic
1122861916 14:104586605-104586627 AGGGAGCAACAGACGTGGAAAGG + Intronic
1202884587 14_KI270722v1_random:92681-92703 AGAGACTACCAGAAGCAGAAAGG - Intergenic
1123681612 15:22768196-22768218 AGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681653 15:22768385-22768407 GGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681664 15:22768427-22768449 GGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681670 15:22768448-22768470 AGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681716 15:22768679-22768701 GGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681747 15:22768847-22768869 GGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681767 15:22768931-22768953 AGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681825 15:22769222-22769244 GGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681840 15:22769306-22769328 CGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681930 15:22769810-22769832 CGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681991 15:22770143-22770165 GGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123805172 15:23863337-23863359 ATGGAGGCTCAGAAGCAGAAAGG + Intergenic
1124145232 15:27118953-27118975 AGGGAACAACAGAAGCAGAAAGG + Intronic
1124333824 15:28842647-28842669 GGGGAGCAGGAGGAGCAGATGGG - Intergenic
1124333830 15:28842668-28842690 AGGAAGCAGGAGGAGCAGATGGG - Intergenic
1124333867 15:28842836-28842858 AGGAAGCAGGAGGAGCAGATGGG - Intergenic
1124417878 15:29489192-29489214 AGGCAGTAGCAGAAGCAGCATGG + Intronic
1124585691 15:31004397-31004419 AGGTAGCCACAGAAGCAGCAGGG - Intronic
1124598430 15:31110921-31110943 GAGGAGCAGAAAAAGCAGAAGGG - Intronic
1125058800 15:35393731-35393753 AGAAAACAGCAGAAGCAGGAAGG - Intronic
1125087872 15:35752330-35752352 AGGGAGAAGGAGAGGGAGAAAGG - Intergenic
1125093874 15:35828494-35828516 AGGCAGCAGCCTAAGTAGAATGG - Intergenic
1125158246 15:36614213-36614235 AGGGAGGAGCAGCAGCAGGGTGG - Intronic
1125333149 15:38601931-38601953 AGAAGACAGCAGAAGCAGAAAGG + Intergenic
1125333722 15:38606883-38606905 AGGAAGCCGCAGAAGCAGAAAGG - Intergenic
1126715114 15:51507617-51507639 AGAAAGCAGCAGCAGAAGAATGG + Intronic
1126851317 15:52798768-52798790 AGGGAGGAGGAGAAACAGAGGGG + Intergenic
1127323009 15:57865850-57865872 AGGGTGCATCAGAACCACAAAGG - Intergenic
1127559593 15:60122710-60122732 AGAAAACTGCAGAAGCAGAAAGG + Intergenic
1128195563 15:65751608-65751630 AGGAATCAGCAAAGGCAGAAAGG + Intronic
1128904005 15:71451480-71451502 GGGGAGCAGCAGATGCAGGCAGG - Intronic
1129205142 15:74033046-74033068 AGGGGACAGCAGGAGCAAAAGGG + Intronic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1130042540 15:80417512-80417534 AGGGAGGAGAAGAAGCAGAGGGG - Intronic
1130090272 15:80815019-80815041 AGGGATCAGGAAAAGCAGTAGGG - Intronic
1130099141 15:80878873-80878895 AGGGAGCAGCAGAGAGAGATTGG - Intronic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131303243 15:91218435-91218457 AGAAAACAGCAGAAGCAGGAGGG - Intronic
1131614673 15:94003938-94003960 AGGGGGCAGCAGAAGGAGAATGG - Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132141426 15:99399954-99399976 AGTGAGCAGCTGAAGATGAAGGG + Intergenic
1132189531 15:99839628-99839650 AGGTAGCTGCAGTAGCTGAATGG + Intergenic
1133023355 16:2976601-2976623 AGGGAGGTGCAGAAACACAAAGG + Intronic
1133220584 16:4317598-4317620 GGGGAGAAGGAGAAGCAGAGGGG - Intronic
1133496520 16:6323330-6323352 AGGGAGCATCATAAGCACCATGG - Intronic
1133895855 16:9928263-9928285 TGGGAGCAAGAGAGGCAGAACGG - Intronic
1134038449 16:11049800-11049822 AGGGGGCAGCAGGAGTAGAGGGG + Intronic
1134490698 16:14693744-14693766 TGGGAGGAGCAGGGGCAGAAAGG - Intronic
1134496079 16:14732862-14732884 TGGGAGGAGCAGGGGCAGAAAGG - Intronic
1135138854 16:19904816-19904838 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1135148306 16:19982979-19983001 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1135945134 16:26858613-26858635 AGGGAGCATCAGGAACAGAGTGG - Intergenic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136154723 16:28374968-28374990 TGGGAGGAGCAGGGGCAGAAAGG + Intergenic
1136208369 16:28740290-28740312 TGGGAGGAGCAGGGGCAGAAAGG - Intergenic
1136264457 16:29106966-29106988 TGGGAGGAGCAGGGGCAGAAAGG - Intergenic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137605220 16:49782673-49782695 AGGGAGAGGCAGTAGGAGAAGGG - Intronic
1137694581 16:50453018-50453040 GAGAAGCAGCAGAAGAAGAAAGG + Intergenic
1137938221 16:52656063-52656085 AGGGAGGAGCAGCAGCAGGGTGG - Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1139325894 16:66152340-66152362 AGGGAGCAAGAGAAGGATAAAGG - Intergenic
1139590098 16:67928611-67928633 AGGGAGCAACAGAGCCTGAAGGG - Exonic
1140155803 16:72425787-72425809 CGGGAGGAGGAGAAGAAGAAGGG + Intergenic
1140622400 16:76751427-76751449 AGTGAACTGCAGAAGGAGAAGGG + Intergenic
1141173993 16:81707563-81707585 AGGGAGCAGGAGTAGAAGCAGGG + Intronic
1141263073 16:82471333-82471355 AAGGAGAAGGAGAAACAGAAGGG - Intergenic
1141798398 16:86290036-86290058 AGGGAACAGCAACAGCAAAAGGG - Intergenic
1141883470 16:86875236-86875258 AGGGAGGAAGAGAAACAGAAAGG - Intergenic
1141915451 16:87093539-87093561 AGGGAGCAGCCAACACAGAAGGG + Intronic
1142099936 16:88265701-88265723 AGGGTGCTGCAGGAGCAGACGGG + Intergenic
1142169147 16:88611481-88611503 AAGGAGCGGGAGAAGGAGAAGGG + Exonic
1142338963 16:89508422-89508444 ACGGAGCAGCAGCAGCAGCACGG - Exonic
1142765901 17:2064150-2064172 AGAGAGCAGCAGAGACGGAAAGG + Intronic
1142879519 17:2873510-2873532 AAGCAGCAGCAGCTGCAGAAAGG + Intronic
1142907185 17:3051847-3051869 AGGCAGTAACAGAAGCATAAAGG - Intergenic
1142927383 17:3252409-3252431 AGGCAGTAACAGAAGCATAAAGG + Intergenic
1143273189 17:5690605-5690627 AGGGAGAGGGAGAAGGAGAAGGG - Intergenic
1143277525 17:5722726-5722748 AGGGAGGAGGAGACACAGAAAGG - Intergenic
1143574293 17:7781034-7781056 TGAGAGCAGCAGAACCTGAATGG - Exonic
1143870279 17:9953310-9953332 AAGGAGTGGCAGAAGCAGCAGGG - Intronic
1144022751 17:11251678-11251700 AGGGAACAGCAGAAGCAAGCTGG - Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144408051 17:14971987-14972009 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1145263602 17:21368925-21368947 AGGAAGGAGCAGAAGCGGAGAGG + Intergenic
1145274766 17:21422868-21422890 GGGGAGCAGCCCAAGCAGGAAGG + Intergenic
1146276575 17:31519820-31519842 AGAGAGCAGCACGAGCAGCACGG - Intronic
1146297194 17:31659270-31659292 AGGGAGGAGGAGAGGGAGAAAGG + Intergenic
1146515636 17:33486976-33486998 AGAGAGGGGCAGATGCAGAAAGG + Intronic
1146946226 17:36875581-36875603 AGAGAGAAGCAGAAGTGGAAAGG + Intergenic
1147426405 17:40347826-40347848 AGGGGGGAGCGGAAGCAGAGGGG + Intronic
1148155625 17:45424026-45424048 AGGAAGCAGAGGTAGCAGAAGGG - Intronic
1148161550 17:45453190-45453212 GGGGAGGAGCAGAAGCTGTAGGG + Intronic
1148236400 17:45972013-45972035 GGGGAGCAGCAGATGCAGCCAGG - Intronic
1148496622 17:48056778-48056800 GGAAAGCAGCAGATGCAGAATGG + Intronic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1149325032 17:55521397-55521419 AGGGAACAAGAGCAGCAGAAAGG - Intergenic
1149381445 17:56098059-56098081 AGAGAGAAGCAGAAGGAGATTGG + Intergenic
1149604216 17:57913578-57913600 AGGGAGGAGCAGAGGCTGCAGGG + Intronic
1150387309 17:64772688-64772710 AGGAAGCAGAGGTAGCAGAAGGG - Intergenic
1150392786 17:64799835-64799857 GGGGAGGAGCAGAAGCTGTAGGG + Intergenic
1150596565 17:66610888-66610910 AGGGTGCAGCAAGAGCAGGAAGG + Intronic
1150727784 17:67665763-67665785 GGGAAGCTTCAGAAGCAGAAAGG + Intronic
1150867435 17:68868222-68868244 TGGGAGCTGCAGAGGCAGCACGG - Intronic
1151051084 17:70979213-70979235 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1151271551 17:73000234-73000256 AGGGAGAAGGAGAAGAAGAGGGG - Intronic
1151351366 17:73534023-73534045 AGGGAGCAGGCGGAGCAGAATGG - Intronic
1151354265 17:73549208-73549230 AGGGAGGAGTAGAAGGAGAGAGG + Intronic
1151441467 17:74132078-74132100 GAGGAGCAGCAGAAGCGGGAAGG - Intergenic
1151441884 17:74134883-74134905 AGGAAACAGCAGAAGCGGGAAGG - Intergenic
1151743067 17:75997067-75997089 GGGACGCAGCAGAAGTAGAAGGG - Intronic
1151785503 17:76273048-76273070 AGGGAGCCTCTGAGGCAGAAAGG + Intergenic
1152415828 17:80161167-80161189 GAGGAGCAGCAGCAGCAGCAGGG + Intergenic
1152574765 17:81135140-81135162 ATGGACCAGCAGCTGCAGAACGG - Intronic
1152743847 17:82030370-82030392 GTGGAGCTGCAGGAGCAGAACGG + Exonic
1154032530 18:10766279-10766301 AGAGAGAAGGGGAAGCAGAAAGG + Intronic
1154110891 18:11567581-11567603 AGGGAGAAGGAGAAGGAGAGGGG + Intergenic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155063228 18:22247039-22247061 AGGGAGGAGGAGGAGCAGGAGGG + Intergenic
1155499054 18:26469041-26469063 GAGGGGCAGCAGAAGCTGAAGGG - Intronic
1155610384 18:27660598-27660620 AGAAAGCAGTAGAAGCAGGAAGG - Intergenic
1155865799 18:30963426-30963448 AGGAACCAGCAGAAGCAGGAAGG - Intergenic
1155938115 18:31775423-31775445 AGGAAACAGCAGAAGCAAGATGG + Intergenic
1156149946 18:34228933-34228955 AGGGAGGAGCAGAAGCAAGTTGG + Intergenic
1156197818 18:34795531-34795553 AGGCAGCAGAGGCAGCAGAATGG + Intronic
1156403543 18:36761586-36761608 AGGGAGCAGCATGAGAAGAGCGG - Intronic
1156596564 18:38554455-38554477 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1156666814 18:39418594-39418616 AAGAAGCAGCAGCAGCAGCAAGG + Intergenic
1157031336 18:43912118-43912140 GGGAAGAAGCAGAAGAAGAAAGG - Intergenic
1157237598 18:45979151-45979173 AGGGAGAAGAAGAAGAAGAGAGG - Intergenic
1157392515 18:47314669-47314691 AGGGAGAGGAAGAAACAGAAAGG - Intergenic
1157400426 18:47382423-47382445 AGAGAGAAGCTGCAGCAGAAAGG - Intergenic
1157445654 18:47745112-47745134 AGGGAACAGCACAAGTAGAAAGG - Intergenic
1157584204 18:48790892-48790914 ATGGCCCAGCAGAAGGAGAAGGG - Intronic
1157728412 18:49983277-49983299 ATGGAGGACCAGAACCAGAAAGG - Intronic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1157786440 18:50487523-50487545 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1157793640 18:50556248-50556270 AGGCAGCAGCTGGAGGAGAATGG + Intergenic
1158015690 18:52780793-52780815 AGAAAACAGCAAAAGCAGAAAGG - Intronic
1158040408 18:53086228-53086250 AGGAAGAAGAAGAAGAAGAACGG - Intronic
1158197132 18:54900622-54900644 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1158248193 18:55455219-55455241 AAGGAGAAGTAGAAGAAGAAAGG + Intronic
1158279790 18:55811732-55811754 AGGGACCAGAAAAAGAAGAAGGG + Intergenic
1158524145 18:58197429-58197451 AGGAAGGAGCAGAAGCAAACGGG - Intronic
1158840744 18:61383872-61383894 AGGGAGAAGCTGAAGTAGTAGGG + Intronic
1158862068 18:61602451-61602473 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1158866484 18:61642722-61642744 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1159491498 18:69140743-69140765 ATGGAGCAAGAGAAGAAGAAGGG + Intergenic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1159922470 18:74238213-74238235 GGGGAGCAGCCCAAGCAGAGGGG + Intergenic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1160175405 18:76590214-76590236 AGGCAGAAGCAGGAGCAAAAGGG - Intergenic
1160356262 18:78230281-78230303 TGGGAGCACCAGAGGCAGAGAGG - Intergenic
1160566814 18:79791018-79791040 AGGGAGAATCAGAGGGAGAATGG - Intergenic
1160893819 19:1393538-1393560 AGGGAGCAGGGGAAGCTGAGTGG + Intronic
1161189270 19:2944249-2944271 AGGGGACAGCAGAAGCAGTCAGG - Intronic
1161298634 19:3532299-3532321 AGGGAGCAGCAGGAGGAGTGTGG + Intronic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161517985 19:4707355-4707377 AGGGAATGGCAGAAGCAGGATGG + Intronic
1161797256 19:6394172-6394194 AAGGAGCAGGAGAAGCACAGCGG + Intergenic
1163153333 19:15427531-15427553 AGGCTGCAGCAGGAGGAGAAAGG + Exonic
1163235657 19:16029087-16029109 AGGAAGAAGAAGAAGAAGAAGGG + Intergenic
1163646083 19:18489873-18489895 AGGGGTCAGCAGAAACAGGAGGG - Intronic
1164816044 19:31204255-31204277 AGGGAGCAAGAGAAGAAGAGAGG - Intergenic
1165159247 19:33806181-33806203 AGGGAGAAACAGAGGCAGACAGG - Intronic
1165364983 19:35359809-35359831 ATGGAGCTGAAGGAGCAGAAGGG + Exonic
1165366802 19:35372278-35372300 ATGGAGCTGAAGGAGCAGAAGGG + Exonic
1165410145 19:35654831-35654853 AGGCATCAGCAGAAGGAGACAGG - Intronic
1165795175 19:38515159-38515181 AGGGAGCAGGGGAAGAAGATGGG + Intronic
1165863322 19:38920463-38920485 AGGGAGGAGGAGAATCAGAGAGG + Intronic
1165912358 19:39237130-39237152 AGGGAGAAGGAGAAGATGAAGGG + Intergenic
1166179393 19:41096069-41096091 AGGGAACAGAAGAAACAGAAGGG + Exonic
1166295421 19:41887148-41887170 ACGGAGCTACAGAAGCAGGAAGG + Intronic
1167290502 19:48622487-48622509 AGGGAGGAGGAAAAGGAGAAAGG - Intronic
1167396567 19:49233261-49233283 AGGGAGACGCTGAAGGAGAAGGG - Intergenic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1167603490 19:50467639-50467661 AGGGCACAGCAGAAGCAGAGAGG + Exonic
1167636811 19:50660052-50660074 AGGGGGCAGCAGAGGGGGAATGG + Intronic
1167779928 19:51592688-51592710 GGGGAGGAGGAGAAGGAGAAGGG + Intergenic
1167835153 19:52062029-52062051 GGGAAGCAGCAGGAGCCGAATGG + Intronic
1168085872 19:54046262-54046284 AGGGAGCAGCAAAAGGAGTGGGG + Intronic
1168346230 19:55651420-55651442 AGGAGGCGGCAGAAGCAGAAGGG + Exonic
1202659999 1_KI270708v1_random:59709-59731 AGAGACTACCAGAAGCAGAAAGG - Intergenic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925203155 2:1985184-1985206 ATTGAGCAGCAGGAGCTGAAAGG - Intronic
925443333 2:3907122-3907144 AGGGAGGAATGGAAGCAGAAGGG - Intergenic
925536041 2:4917777-4917799 AGGGAGAAGGAGAAACAGAAAGG - Intergenic
925812349 2:7712871-7712893 AGGGAACAGGAGAGGCACAATGG - Intergenic
926042069 2:9681408-9681430 AGGTGGGAGCAGAAGAAGAAGGG - Intergenic
926049679 2:9736842-9736864 AGGCAGCAGTAGACACAGAAAGG - Intergenic
926055595 2:9772173-9772195 AGAGTGCTGCAGAAGCACAAAGG + Intergenic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926686007 2:15698073-15698095 AGGCAGAGGCAGAGGCAGAATGG + Intronic
926801415 2:16664164-16664186 AGGGGGCAGCAGCAGCATCACGG - Intronic
927203685 2:20593770-20593792 AGGGACCAGCAGGGGCAGCAGGG - Intronic
927423805 2:22958905-22958927 AGAGGGCAGTGGAAGCAGAAAGG - Intergenic
927766180 2:25810540-25810562 AGCGAGAAGCTGAAGGAGAAAGG - Intronic
927818243 2:26239751-26239773 GGTTAGCACCAGAAGCAGAATGG + Intronic
927866180 2:26589159-26589181 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
928032780 2:27795929-27795951 AGGCAGCAGGAGAAACAGAGGGG - Intronic
928289156 2:30022435-30022457 AGTGAGCCACAGAAGCAGCATGG - Intergenic
928342729 2:30459255-30459277 AGGGAGAAGCAGAAGCTCCAAGG + Intronic
928533794 2:32219399-32219421 AGGGGGCAGAAGAAGGAGGAGGG - Intronic
929002481 2:37361678-37361700 AGGGAGCAGCTGATCTAGAATGG - Intronic
929265941 2:39919825-39919847 AGACAGCAGCAGCAGCAGCAAGG + Intergenic
929317491 2:40497463-40497485 AGGGGGCAGTGGGAGCAGAAAGG + Intronic
929479262 2:42287907-42287929 AGGAAGCATAAGATGCAGAAGGG + Intronic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929899231 2:45986893-45986915 AGAGAGCAGAAGAGGAAGAAGGG + Intronic
930189796 2:48445709-48445731 TGGGAGCAGGAGCAGGAGAAAGG + Intronic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
931266192 2:60662316-60662338 AGAGAGCAGTGGAAGCAGGAAGG - Intergenic
931283647 2:60814985-60815007 AGTGAACAGCCGATGCAGAATGG - Intergenic
931908561 2:66869428-66869450 AGGGAACTGCAGAAGGAGTAAGG + Intergenic
932068260 2:68589609-68589631 AGGGGGCAGTAGAAGCAGAGAGG + Intronic
932476354 2:72008771-72008793 CGGGAGCACCAGGAGGAGAAGGG + Intergenic
932740879 2:74290301-74290323 AGGCAGCAGCGGAAGCAGGCTGG - Intronic
933082274 2:78005775-78005797 AGAGAGCTTCAGAAGCAGAGTGG - Intergenic
933284533 2:80371168-80371190 AGAAATCTGCAGAAGCAGAAAGG - Intronic
933368082 2:81380135-81380157 AGAGAGCAGCAGAGAGAGAATGG + Intergenic
933496240 2:83053597-83053619 AGGAAGAAGAAGAGGCAGAAGGG + Intergenic
933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG + Intergenic
934131187 2:88950645-88950667 AGGCAGGAGCAGAAGATGAATGG - Intergenic
934709732 2:96507047-96507069 AGAAAACAGCAGAAGCAGGAAGG + Intronic
935091811 2:99901802-99901824 AGGGAGCAACATAATCAGACTGG - Intronic
935220504 2:101008294-101008316 AGGTAGCAGCAGAACCAGGGTGG + Intronic
935281895 2:101525652-101525674 GGGGAGCAGAGGAAGCAGCAAGG + Intergenic
935625527 2:105169350-105169372 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
935926071 2:108070288-108070310 AGGGAGCAGCAGAAAGGGACAGG - Intergenic
936247674 2:110842800-110842822 AGAAAACAGCAGAAGCAGGAAGG - Intronic
936379409 2:111970751-111970773 AGGGAGGAGGAGGAGGAGAAGGG - Intronic
936489616 2:112958877-112958899 AGGACGCAGCAAAATCAGAAAGG - Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936502494 2:113077416-113077438 AGGAAGAAGAAGAAGAAGAAGGG - Intergenic
936650461 2:114420809-114420831 AGGGACAGGGAGAAGCAGAAAGG - Intergenic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937688863 2:124731022-124731044 AGGCAGCAACATAAGAAGAATGG - Intronic
937771309 2:125723487-125723509 AGAGAGCAGGCCAAGCAGAAAGG - Intergenic
937815484 2:126245877-126245899 GGTGAGCCGCAGAAGAAGAAGGG - Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938141784 2:128800363-128800385 AGGCAACAGCAGAAGCAGCCAGG + Intergenic
938421086 2:131147385-131147407 AGTGAGCAGCAGCAGCAGCTAGG - Exonic
938780653 2:134581814-134581836 AAGAAGCAGCAGAACCAAAAAGG + Intronic
939316412 2:140556154-140556176 AGAAAACAGCAGAAGCAGGAAGG + Intronic
940097408 2:149993294-149993316 AGGAAATAGCAGAAGCAGGAAGG - Intergenic
940274785 2:151927947-151927969 AGGCAGCAGCAGAAACTGAAAGG + Intronic
940538551 2:154979880-154979902 AGGAAGCAGGAGAGGCAGACAGG + Intergenic
940982949 2:160023842-160023864 AGGGAGTAGCAGAAACAACACGG + Intronic
941012902 2:160321332-160321354 AGGGAGAAGAGGAAGCTGAATGG - Intronic
941509553 2:166388775-166388797 ATTGTGCAGGAGAAGCAGAACGG - Intergenic
941762947 2:169264874-169264896 CTGGAGGAGCTGAAGCAGAATGG + Intronic
942095996 2:172537156-172537178 AGGCAGAGGCAGAGGCAGAAAGG - Intergenic
942909577 2:181226960-181226982 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
943538546 2:189182946-189182968 AGGTACTAGCAGAAGAAGAAAGG - Intergenic
943617919 2:190115210-190115232 AGAGAGAAGGAGAAGTAGAAAGG + Intronic
944230493 2:197387163-197387185 AGTAAGCAGCAGAAGCAATACGG + Intergenic
944456746 2:199902829-199902851 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
944739111 2:202594399-202594421 AGGGATCGGGAGAAGGAGAAGGG - Intergenic
944900344 2:204207560-204207582 AGGAAACAGCAGAAGTAGGAAGG - Intergenic
945000528 2:205345493-205345515 AGTAAACAGCAGAAGCAGGAAGG - Intronic
945045876 2:205781380-205781402 AGGTAGGAGCAGAAACAGACCGG - Intronic
945137524 2:206644273-206644295 AGGGAGCAGGTGAAGCTCAAGGG - Intergenic
945371625 2:209025631-209025653 AGTGAGCAACAGATGCAGAGAGG + Intergenic
945855838 2:215068709-215068731 AGGCAGCAGCAGGAGGAAAAGGG - Intronic
946276883 2:218638359-218638381 GGGGAGCGGCAGGAGCAGGAGGG + Exonic
946335792 2:219035678-219035700 AGGGAGAAGGGGGAGCAGAAAGG + Intronic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
947314024 2:228835578-228835600 AGACAGCAGCAGCAGCAGCAAGG - Intergenic
947488399 2:230573130-230573152 AGGGAGGAGCAGCAGCAGGGTGG + Intergenic
947807040 2:232976213-232976235 AGGGAGCAACAGAAGAGGACTGG - Intronic
948386123 2:237582107-237582129 AGGCAGGAGCAGAGGCAGAACGG - Intronic
948536374 2:238650506-238650528 AAGGCGTAGCAGGAGCAGAAGGG - Intergenic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948558568 2:238835269-238835291 AGGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558571 2:238835275-238835297 AGGGAGAGGGAGAAGGAGAAGGG - Intergenic
948877407 2:240837012-240837034 TGGGAGCAGCAAAAGCAGAGGGG - Intergenic
948897323 2:240933533-240933555 AGGGAGCCTGAGAAGCAGACAGG - Intronic
948992760 2:241563151-241563173 CGGGAGCAGCAGGAGCAGGGAGG - Intronic
1168771890 20:420871-420893 CGGAAGCAGCAGCAGCAGGAGGG + Exonic
1169136310 20:3199929-3199951 AGGGAGCTGCATAAGAAGCAAGG + Intronic
1169178631 20:3542573-3542595 AGGGAGAAGGGGAAGGAGAAAGG - Intronic
1169984653 20:11430507-11430529 AGGGAGAAGAAGGAGCAGAGAGG - Intergenic
1170392815 20:15893872-15893894 ATGGAGCAGGAGCAGCTGAAAGG + Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170624523 20:18021221-18021243 AGGCAGCAGCAGCAGCAGTAGGG - Intronic
1170673188 20:18454070-18454092 AGGGAGCAGCACATGCAGGCAGG + Intronic
1170940684 20:20845654-20845676 AAGGAGGAACAGAAGCAGAAAGG + Intergenic
1171383147 20:24748280-24748302 TGGGAGCAGCAGAAGGAAACAGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172468060 20:35171863-35171885 AGGAAGCAGCCCAAGGAGAAGGG + Intergenic
1172753103 20:37264901-37264923 AGGGAGCAGACGAAGCAGTTGGG + Intergenic
1173070851 20:39763550-39763572 AGGGTGGAGCAAATGCAGAAGGG + Intergenic
1173142486 20:40496160-40496182 GGCAAGCAACAGAAGCAGAACGG - Intergenic
1173350732 20:42243024-42243046 AGGCAGAGGCAGAGGCAGAAAGG + Intronic
1173849500 20:46209092-46209114 AGGAAGCAGCAGAGGAAGACAGG + Intronic
1174933287 20:54839589-54839611 AGGGCCCAGCAAAAGCAAAACGG - Intergenic
1175329236 20:58151227-58151249 AGGGAGAAGGAGACGGAGAAAGG - Intronic
1175389395 20:58616839-58616861 AGGGGAGGGCAGAAGCAGAATGG - Intergenic
1175485278 20:59341846-59341868 AGTGAGCAGCAGGAGACGAAAGG + Intergenic
1175571526 20:60026425-60026447 AGGGAGAAGAGGAGGCAGAAGGG + Intronic
1175619556 20:60431740-60431762 AGGGAGCAGGTGGAGAAGAAAGG - Intergenic
1175888963 20:62307662-62307684 AGGCAGCTGCTGGAGCAGAAGGG - Exonic
1176033392 20:63024736-63024758 AGGGAGGTGGAGATGCAGAAGGG - Intergenic
1176669620 21:9720833-9720855 AGGAATGAGCAGGAGCAGAATGG + Intergenic
1176999395 21:15593328-15593350 AGAAAACAGCAGAGGCAGAAAGG + Intergenic
1177057119 21:16319636-16319658 AGGAAGAAGAAGAAGAAGAAAGG - Intergenic
1177588989 21:23137065-23137087 AGGGAACAGCACAATCACAAGGG + Intergenic
1177643437 21:23872692-23872714 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1177693660 21:24542915-24542937 TGGGAGCAGAAGAAGTAGTATGG + Intergenic
1177731379 21:25031071-25031093 GTGGAGCAGCAGAAACAAAAGGG + Intergenic
1178135264 21:29619774-29619796 AAGCAGCAACAGAAGCAGCATGG + Intronic
1178158377 21:29881697-29881719 ATGGTGCAGTAGAAGAAGAAAGG - Intronic
1178385347 21:32144452-32144474 AGAAAACAGCAGAAGCAGAAAGG + Intergenic
1178848529 21:36193560-36193582 AGAAAACAGCAGAAGCAGGAAGG - Intronic
1179049999 21:37880992-37881014 AGGGCACAGAAGAGGCAGAAGGG + Intronic
1179081052 21:38170864-38170886 AGGAATCAGCAGAAACACAATGG + Intronic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1179270025 21:39843689-39843711 AGGGAGGAGGAGAAGGAGAGAGG + Intergenic
1180327475 22:11443290-11443312 AGAGACTACCAGAAGCAGAAAGG - Intergenic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1181517130 22:23421269-23421291 AAGGAGCCCCAGAAGCAGCATGG + Intergenic
1181615623 22:24052239-24052261 AGGGAGAAGTAGAAGCAAGAGGG + Intronic
1181725995 22:24811308-24811330 AGGGCGCAGCAGGTGCAGGATGG - Intronic
1181733662 22:24865716-24865738 AGGGAGGGGCAGGAGCAGACAGG + Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181963708 22:26642031-26642053 AGGGGGCAGGAGAGGGAGAAAGG - Intergenic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182962417 22:34488213-34488235 AGGGAGGAACAGAGGAAGAAAGG - Intergenic
1183107939 22:35627965-35627987 AGGGGGCAGGAGAAGCAGAGAGG + Intronic
1183111770 22:35654825-35654847 AAGAAGCAGCAGATGCAGGAAGG + Intronic
1183362107 22:37388054-37388076 AGAGACCAGCAGGAGCAGTAGGG - Intronic
1183475569 22:38034119-38034141 TGGGAGTAGAGGAAGCAGAAGGG - Intronic
1183631576 22:39036206-39036228 AGGGAGGGGCATGAGCAGAAGGG - Intergenic
1184032676 22:41904198-41904220 AGGGAGCAGCAGAATGGAAATGG - Intronic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1185301232 22:50082142-50082164 CGGGACCAGCTGAAGCAGGAGGG + Intronic
1185330243 22:50249115-50249137 TGGGAGCAGCAGGTGCAGGAAGG + Exonic
1185336405 22:50272509-50272531 AGGGACCAGCAGGACCAGAGAGG - Intergenic
949312324 3:2713648-2713670 AGCAAACAGCAGAAGCAGGAAGG - Intronic
949366270 3:3285001-3285023 AGGAAGAAGGAGAAGGAGAAGGG - Intergenic
949700271 3:6748673-6748695 AAGGAGGAGGAGAAGGAGAAGGG - Intergenic
949748236 3:7320599-7320621 AGGAAACAGAAGAAGCAGGAAGG - Intronic
949875340 3:8623026-8623048 TGGCTGCAGCAGCAGCAGAAGGG + Intronic
949957927 3:9285357-9285379 AGAAAACAGCAGAAGCAGGAAGG + Intronic
950524822 3:13517550-13517572 TGGGAGCTGCAGAAGCCGAGGGG - Intergenic
950703011 3:14762968-14762990 AAGGAGGAGCAGATGCTGAAAGG + Intronic
950808855 3:15632379-15632401 AGGGAACAGCAGAACCAGGAAGG - Intronic
950958225 3:17077929-17077951 AGCCAGCAGAGGAAGCAGAATGG - Intronic
950980865 3:17303099-17303121 GGGGAGCAGCAGAAAGAAAAGGG - Intronic
951457328 3:22907243-22907265 AGGGGACAGCAGCAGGAGAATGG + Intergenic
951771128 3:26258822-26258844 AAGGAGGACCAGTAGCAGAATGG + Intergenic
952053250 3:29412352-29412374 AGAGAACTGCAGAAGGAGAAGGG + Intronic
952277601 3:31892444-31892466 TGGGAGCAGAGGGAGCAGAAAGG + Intronic
953342722 3:42149310-42149332 AGGGAGTAGGAGGAGCAGAAAGG - Intronic
953847631 3:46440667-46440689 TAGAAGGAGCAGAAGCAGAAGGG + Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954677007 3:52321667-52321689 AGGGAGCAGCAGATGCCGCCAGG - Intronic
954788001 3:53109088-53109110 AGGGTGCAGCAGAAGATGACAGG - Intronic
954798017 3:53171415-53171437 AGGGGTCAGCAGGAGCATAATGG - Intronic
955081473 3:55661466-55661488 AGGCAGCAGAAGAGGCAGAGAGG - Intronic
955150639 3:56363506-56363528 AGTGAGAAGCAGAAGCAAATAGG + Intronic
955512082 3:59691446-59691468 AGAAAGCAGCAGAGGCAGATGGG - Intergenic
955567356 3:60261725-60261747 AGGAAACAGCAGAAGCAAGAAGG + Intronic
955702621 3:61697046-61697068 AGAAAACAGCAGAAGCAGAAAGG + Intronic
956297510 3:67730175-67730197 AGGAAGCAGGACAAGCAGAGGGG + Intergenic
956308865 3:67856934-67856956 ATGGACCAGCAGCAGCAGCATGG + Intergenic
956530411 3:70211747-70211769 AGGGAGAAAGAAAAGCAGAAAGG - Intergenic
956530431 3:70211847-70211869 AGGGAGAAAGAAAAGCAGAAAGG - Intergenic
956725547 3:72153650-72153672 AGGGAGCAGCTGAAGCACAGAGG + Intergenic
957261283 3:77905258-77905280 AGAAAACAGCAGAAGCAGAAAGG - Intergenic
957315806 3:78575200-78575222 AGGAAACAGCAGAAGTAGGAAGG - Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957781821 3:84828441-84828463 AGTGAGCAGAGGAAACAGAATGG - Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
959157495 3:102684644-102684666 AGAAAGCAGCAGAAGCAGAAAGG + Intergenic
959480721 3:106869048-106869070 AGAAAACTGCAGAAGCAGAAAGG + Intergenic
959564901 3:107824263-107824285 AGAAAACTGCAGAAGCAGAAAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960052596 3:113252527-113252549 ATGGAGAAGCAGTAACAGAATGG + Intronic
960141955 3:114159524-114159546 AGGGAGCTGGAGGAGAAGAAAGG + Intronic
960155577 3:114294381-114294403 AAGGAGCAGGAGAAGAAGAAGGG + Intronic
960507658 3:118513062-118513084 AGAAAACAGTAGAAGCAGAAAGG + Intergenic
960680170 3:120239394-120239416 AGGAAGAAGAAGAAGAAGAAGGG - Intronic
960738499 3:120806392-120806414 AAGAAGCAGCAGAAACACAAGGG + Intergenic
961517399 3:127446512-127446534 AGGCTGCAGAAGAAGCAGGATGG + Intergenic
961531620 3:127543724-127543746 GGGCAGGAGCAGAAGCAGCAAGG + Intergenic
961661950 3:128473630-128473652 TGGGAGAAGGAGAAACAGAATGG + Intergenic
961804057 3:129476134-129476156 AGGGAGATGCAGAGGCAGAGAGG + Intronic
961819849 3:129570456-129570478 GGGGAGCAGGAGGAGCAGAGAGG - Intronic
962614781 3:137114172-137114194 AGAAAACTGCAGAAGCAGAAAGG - Intergenic
963094394 3:141520334-141520356 AGGGATTGGCAGAAGCAGAGGGG + Intronic
963429563 3:145181267-145181289 AGGGAGCTGCAGAGGCACAAAGG + Intergenic
964548932 3:157865485-157865507 AGGCAGCTGGAGAAGCAGCAGGG - Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965707558 3:171524368-171524390 AGCAAGCAGCAGAAGGGGAAAGG + Intergenic
965848345 3:172990963-172990985 AGTGAGCAGCAGCAGGAGAAGGG + Intronic
966012493 3:175098161-175098183 AGGGAACAGCAGACACAGAAGGG - Intronic
966319618 3:178686589-178686611 AGAGAACAGCAAAAGCAGGAAGG - Intronic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
967266116 3:187693741-187693763 AGGGAACAGCAGAATTTGAAGGG + Intergenic
967332820 3:188308966-188308988 AGGGAGGAGGAGAAGGAGAAAGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967454636 3:189669857-189669879 AGAAAGCAGCAAAAACAGAAGGG + Intronic
967466156 3:189808305-189808327 ATGGACCAGCAGATTCAGAACGG + Exonic
967478034 3:189943322-189943344 AGGAAGCAGCATCAGCAGTAGGG + Intergenic
967527753 3:190514179-190514201 AGGGCGCAGCAAAAGCAGCCGGG - Exonic
967648183 3:191952405-191952427 GGGCCGCAGCAGAAGGAGAAAGG + Intergenic
967808132 3:193732944-193732966 AGGGTCCAGGGGAAGCAGAAAGG + Intergenic
967936838 3:194735449-194735471 AGACAGCAACAGAAGAAGAAAGG - Intergenic
968463693 4:738987-739009 AGGGAGCAGCAGGTGCAGCAAGG - Intronic
968706856 4:2082759-2082781 ACAAAGCAGCAGAAGCTGAAAGG - Intronic
968817234 4:2828419-2828441 AGGGAGCGGCAGGAGAAGAGGGG - Intronic
968973554 4:3809591-3809613 AGGGAGAAGCAGATGCTCAAGGG + Intergenic
969239478 4:5889193-5889215 AGGGAACAGCAGGGACAGAAGGG + Intronic
969240860 4:5896388-5896410 AGGGACCAACAGAGGCAGCAGGG + Intergenic
969637905 4:8379986-8380008 AGGGAGCAGTGGAAGCTGACAGG + Intronic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
969721508 4:8895030-8895052 GGGGAGCAGCAGCAGGACAAGGG - Intergenic
970103846 4:12557463-12557485 AGGCAATAGCAGAAGCACAAGGG + Intergenic
970525096 4:16924111-16924133 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
970531524 4:16990176-16990198 AGAGAACAGCAGAAGCAGGGAGG + Intergenic
971221080 4:24706475-24706497 AGAGAGAAGAAGAAGGAGAAGGG - Intergenic
971342448 4:25782948-25782970 TGGGAGAAGCAGAAGCAGAAGGG + Intronic
971425638 4:26512452-26512474 AGGGAACAGGAGGAGCAGGAGGG + Intergenic
971850770 4:31983911-31983933 ATGGTGCAGGAAAAGCAGAAAGG + Intergenic
972581349 4:40398270-40398292 AGGAAGCTGCAGAAGCTGAGGGG - Intergenic
972591557 4:40492923-40492945 ATGGAGGAGGGGAAGCAGAAGGG - Intronic
972658709 4:41092887-41092909 AGGGTGAAACAGCAGCAGAATGG - Intronic
973851196 4:54963222-54963244 TGGGAGAAGGAGGAGCAGAAGGG - Intergenic
974359941 4:60864453-60864475 AAGAAGCAGCTGAACCAGAAGGG + Intergenic
974439590 4:61899088-61899110 ATGGAGCTGCAGAGGTAGAAAGG - Intronic
974832128 4:67202412-67202434 AGAAAACAGCAAAAGCAGAAAGG + Intergenic
975391464 4:73822884-73822906 AGGGAGAAGAAGAGGGAGAAAGG + Intergenic
977536880 4:98263809-98263831 GGGGATAAGCAGAAACAGAAAGG + Intronic
977585776 4:98773912-98773934 AGGGAGGAGGAGAGGCAGGAGGG - Intergenic
977962056 4:103097595-103097617 AGGGAGGAGCAAAAGCCAAAAGG + Intronic
977969542 4:103197982-103198004 AGGGAGGAGCAGATGCCGCAAGG + Intronic
978084093 4:104628932-104628954 TGTGGGCAGCAGAAGGAGAAAGG + Intergenic
979678065 4:123431163-123431185 AAGAAGCAGCAGCAGCAGCAGGG - Intergenic
980520957 4:133933744-133933766 TGGGAGGAGCAGAAGCATAAAGG + Intergenic
981625307 4:146748005-146748027 AGGCAGATGCAGAAGCAGCAAGG - Intronic
981868468 4:149456788-149456810 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
982234700 4:153241622-153241644 AGGGAGCAGGAGCAACAGCAGGG + Intronic
982560307 4:156921478-156921500 AAGGAGGAGGAGAAGGAGAAAGG + Intronic
982772832 4:159414016-159414038 AGTGAGTAGCAGAAGCAAACAGG + Intergenic
983690927 4:170468134-170468156 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
983811060 4:172062881-172062903 AGGTAGCAAAGGAAGCAGAAAGG - Intronic
984657163 4:182330523-182330545 AGAAAACAGCAGAAGCAGGAAGG - Intronic
985250281 4:188016933-188016955 AGGGAGGAGGAGGAGCAGACAGG + Intergenic
985405155 4:189630632-189630654 AGGAATGAGCAGGAGCAGAATGG - Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986211761 5:5680048-5680070 AGGCAGCATCAGAAGCATGAAGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986245246 5:6001144-6001166 AGAGAGCAGAGGACGCAGAAAGG - Intergenic
986392620 5:7300297-7300319 CGGAAGCAGGAGAAGCAGATGGG - Intergenic
986561408 5:9063761-9063783 AGGCAGCAGCAGCAGCAGGTGGG + Intronic
986704712 5:10445534-10445556 AGGAAGCAGCACAGGAAGAAGGG + Intronic
986731298 5:10636758-10636780 AGGGTGCAGCAGAGGGAGAGAGG + Intronic
986847280 5:11770192-11770214 AGGGAGAGACAGAAGAAGAATGG + Intronic
986896486 5:12376842-12376864 AGGGTGCAGCAGAAAAATAATGG + Intergenic
987259596 5:16189946-16189968 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988435319 5:31167652-31167674 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
988980957 5:36568733-36568755 TGGGTGAAGTAGAAGCAGAATGG + Intergenic
989143040 5:38221019-38221041 AGAAAACAGCAAAAGCAGAAAGG - Intergenic
989238509 5:39176908-39176930 AGGCAGGAGCAAAAACAGAAAGG + Intronic
989582417 5:43045280-43045302 AGGTAGCAGAAGAAGTAGTATGG - Intergenic
990184216 5:53195736-53195758 AGGGAAGAGTAGAAGCAGGAAGG + Intergenic
990225748 5:53650708-53650730 AGAAAACAGCAGAAGCAGGAAGG - Intronic
991035875 5:62126951-62126973 ATGCAGCAGCAGAAAAAGAATGG + Intergenic
991036402 5:62131940-62131962 AGGGAGCAGGAGAAGGGGGATGG - Intergenic
992158619 5:73979462-73979484 AGTCAGAAGGAGAAGCAGAAAGG + Intergenic
992620899 5:78591776-78591798 TGGGGGCTGCAGAAACAGAAAGG + Intronic
992754230 5:79889171-79889193 AAGGAGAAGCTGTAGCAGAATGG + Intergenic
993002895 5:82400017-82400039 AGGGAGTAAGAGAAGTAGAATGG - Intergenic
993044702 5:82854103-82854125 AAGGAGCAGCATAAGCAAAATGG + Intergenic
994145083 5:96385712-96385734 ATGGAGCAGAAGGAGCAGAGTGG + Intergenic
995549747 5:113269048-113269070 AGGCAGCAGCACAAACAGATGGG + Intronic
995873473 5:116766178-116766200 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
996430678 5:123373120-123373142 AGAGACCACCAGAAGCAGAGAGG + Intronic
996552675 5:124746814-124746836 AGGGAGGAGGAGGAGAAGAAAGG + Intronic
996831560 5:127746094-127746116 AGGGAGTGGGAGAAGCTGAAAGG + Intergenic
997383891 5:133457494-133457516 AGAAAGCAGCAGAAGTGGAAAGG - Intronic
997430300 5:133833701-133833723 AGGAAGAGGCAGAAGCAGAAAGG + Intergenic
997462978 5:134067624-134067646 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
998408064 5:141885742-141885764 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
998940746 5:147280080-147280102 GGGGAGAAGAAGCAGCAGAAAGG + Intronic
999001957 5:147933688-147933710 AGAGAGCAGCAGATGTATAAGGG + Intergenic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999720038 5:154392650-154392672 AGGCAGCAGGATGAGCAGAAAGG + Intronic
999745803 5:154590847-154590869 AGGGAGCATGTGAAGCAGACAGG - Intergenic
999912035 5:156212076-156212098 AGCCAGCAACAGAAGAAGAAAGG + Intronic
1000113609 5:158133017-158133039 AGGGAACAGCAGAAGAAGGGTGG + Intergenic
1000166740 5:158657163-158657185 AGGCAGAAGTAGAAGCAGTAGGG - Intergenic
1001280614 5:170383782-170383804 AGGGACCAGGAGGAGCTGAAGGG - Exonic
1001543711 5:172557113-172557135 AGGGAGCAGAAGCAGGAGGAGGG - Intergenic
1001595637 5:172896998-172897020 AGGCAGCAGCAGATGGAGACTGG - Exonic
1001775279 5:174324224-174324246 AGGGTGCAGAAGCAGCAGAGGGG + Intergenic
1002961195 6:1916268-1916290 AGGGTGCAGCTGAAGGAAAATGG + Intronic
1002968198 6:1988939-1988961 AGTGAGCAGTAAGAGCAGAAAGG + Intronic
1002972715 6:2040694-2040716 AGAAAACAGCAGAAGCAGGAAGG + Intronic
1003075848 6:2983128-2983150 AGGGAGGAGGAAAAGAAGAAAGG - Intergenic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1003149410 6:3536241-3536263 AGGGTACTGCAAAAGCAGAACGG - Intergenic
1003241625 6:4350309-4350331 TGGGAGCAGGAGAAGCTGAGAGG - Intergenic
1003257714 6:4488806-4488828 AGGGTGCAGTAAAGGCAGAAAGG + Intergenic
1003796092 6:9606725-9606747 AGAAAGCAGCAGGAGAAGAAAGG - Intronic
1003976689 6:11351437-11351459 AGAAAACAGCAAAAGCAGAAAGG + Intronic
1004420614 6:15466235-15466257 AGGAAACAGGAGAAGCAGGAGGG - Intronic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004462717 6:15853434-15853456 AAGAAGAAGGAGAAGCAGAAGGG - Intergenic
1005979194 6:30823434-30823456 AAGGAGGAGAAGAAGAAGAAGGG - Intergenic
1006003104 6:30982057-30982079 AGTGAGCTGGAGAAACAGAAAGG - Intergenic
1006906577 6:37537175-37537197 AGGGAGCTGGAGAAGGAGAGCGG - Intergenic
1007534729 6:42576424-42576446 GGGCAGCAGCAGCAGCAGAATGG - Intronic
1007937856 6:45749916-45749938 AGGGAAGTGCAGAGGCAGAATGG + Intergenic
1008788016 6:55193862-55193884 AGGGAGGAGCGGAAGAGGAAAGG - Intronic
1010765215 6:79771057-79771079 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1011421332 6:87176540-87176562 AGAAAGTAGCAGAAGCAGGAAGG - Intronic
1011465083 6:87647083-87647105 GGGGAGCAGAAAAACCAGAAAGG - Intronic
1011618168 6:89217047-89217069 GGGGAGCAGCAGGAGAACAAAGG + Intronic
1011816460 6:91196998-91197020 TGGGAGGGGGAGAAGCAGAAAGG + Intergenic
1012138047 6:95583705-95583727 AGGGAGCACGAGAAGTGGAAAGG + Intronic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1013732774 6:113188395-113188417 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1014425394 6:121298660-121298682 ATTGAGCAGCAGAAGAAGAGAGG - Intronic
1015106732 6:129545362-129545384 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015824834 6:137300625-137300647 AGAGAACAGCAGAAGCAGGAAGG - Intergenic
1016519752 6:144933614-144933636 TGGGAGCAGCCCAAGCAAAAGGG - Intergenic
1016560667 6:145392419-145392441 AAGGAGCAGTAGAAGGAGAATGG - Intergenic
1016801470 6:148173501-148173523 AAGGAGAAGGAGAAGAAGAAGGG + Intergenic
1016851084 6:148619652-148619674 AGGGTGTAGCGGAAGCAGATGGG + Intergenic
1017027085 6:150190866-150190888 AGGGAGCAAGAGAGGAAGAAGGG - Intronic
1017037684 6:150281107-150281129 AGGAAGCAAGAGAAGCAGCAAGG - Intergenic
1017041864 6:150314416-150314438 AGGGAGGAGGAGGAGGAGAAAGG + Intergenic
1017236553 6:152122559-152122581 GAGGAGCAGGAGAAGCTGAAGGG + Exonic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017439056 6:154445834-154445856 AGGAAGGAGGAGAAGAAGAAAGG + Intronic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018038111 6:159898783-159898805 AGGGAGGAGAAGGAGAAGAAGGG - Intergenic
1018267802 6:162043768-162043790 AGGAAGCAGCAGGAAGAGAAAGG + Intronic
1018632066 6:165829883-165829905 AGGGAACAGCACCAGAAGAAAGG + Intronic
1018804846 6:167250381-167250403 AGGGAGCAGCAGGTGCTCAAAGG + Intergenic
1019032297 6:169024112-169024134 AATCAGCAGCAGAAGCAGAGGGG + Intergenic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019208764 6:170386710-170386732 AGAGAGCAGAAGAAGAAGGAAGG + Intronic
1019665436 7:2249855-2249877 AGGGAGCTGCAGGAGGAGAGCGG + Exonic
1019890745 7:3943915-3943937 AGGTAGCTTCAGAGGCAGAAAGG - Intronic
1019959826 7:4449804-4449826 AGGGGGCAGCAGCAGGAGCAGGG - Intergenic
1020020673 7:4865802-4865824 TGGCAGCAGCGGAGGCAGAAAGG + Intronic
1020140811 7:5610637-5610659 TGGGGGCAGCAGAGGGAGAAGGG + Intergenic
1020594404 7:10186765-10186787 AGAAAAGAGCAGAAGCAGAAAGG + Intergenic
1020861460 7:13496940-13496962 AATGAGCAGCAGCAGCAGAAAGG + Intergenic
1020888186 7:13846107-13846129 AGAAAACAGCAGAAGCAGAAAGG + Intergenic
1021307923 7:19054182-19054204 GGGAAACAGAAGAAGCAGAAAGG + Intronic
1021524233 7:21568745-21568767 AGGGGGCTGCTGAAGCAGAAAGG + Intronic
1022088104 7:27088245-27088267 AGGAAGCAGGAGAAACGGAACGG + Intergenic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022530600 7:31064716-31064738 AGTGGGGAGCAGAAGCAGAGAGG - Intronic
1022538214 7:31111369-31111391 TGGCAGCAGCAGTAGCAGTAAGG - Exonic
1022664251 7:32395404-32395426 AGGCATCAGCAGAGGCACAAAGG + Intergenic
1023172286 7:37401329-37401351 AGAAAACAGCAGAAGCAGGAAGG + Intronic
1023319854 7:38983363-38983385 AGGCAGGAACAAAAGCAGAAAGG - Intronic
1024150800 7:46569532-46569554 GGTGAGGAGGAGAAGCAGAATGG + Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024912928 7:54466727-54466749 AGGGAGCAGAAAGGGCAGAAAGG + Intergenic
1025167272 7:56723404-56723426 AGAAAACAGCAAAAGCAGAAAGG - Intergenic
1025284351 7:57650144-57650166 ACAGAGCAGAAGAAGCAGGAGGG + Intergenic
1026837862 7:73650062-73650084 GGGGGGCAGCAGAGGCAGAAGGG + Intergenic
1027233975 7:76287074-76287096 TGGGAGCAGCAGAAGAGGACTGG - Exonic
1027428110 7:78082328-78082350 GGGGAGGAGGAGAAGCAGAGGGG + Intronic
1027501521 7:78957847-78957869 AGGGAGCAGCAGCATCAGGCTGG - Intronic
1027953063 7:84843821-84843843 AGGGAGAAGCAGAAACAACATGG - Intergenic
1028651830 7:93158511-93158533 AGTGAGCAGCAAGACCAGAATGG + Intergenic
1028813135 7:95111862-95111884 AGGGAGAAGAGGGAGCAGAAAGG + Intronic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1031053790 7:116972131-116972153 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
1031974551 7:128085493-128085515 TGGGAGCAGAAGAGGGAGAAAGG - Intronic
1032002668 7:128275604-128275626 AGGGAGAGGCAGGAGCAGAATGG + Intergenic
1032156137 7:129469886-129469908 ATGGAACATCAGAACCAGAAGGG + Intronic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032640369 7:133759754-133759776 AGGGAAAAGAAGAAGGAGAAAGG + Intronic
1032672628 7:134099260-134099282 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1033069437 7:138188689-138188711 AGGGAGCAGCAAAGGCTGGAGGG + Intergenic
1033206471 7:139427291-139427313 AGGTAGCAGCAGAAACATTAGGG + Intergenic
1033265649 7:139884456-139884478 AGGGAGCTGGAGCAGCAGGAAGG + Intronic
1033401358 7:141027914-141027936 AGGGAGTAACAGAAACAAAAAGG - Intergenic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033649875 7:143332700-143332722 TGGGAGAGGAAGAAGCAGAAAGG - Intronic
1033717639 7:144019142-144019164 AGGGAGCAGTTGATGCTGAATGG + Intergenic
1034132738 7:148735458-148735480 AGTGAGCAGGCGAAGCAGGAAGG - Intronic
1034248708 7:149670980-149671002 AGAGAGTTGCAGAAGCAGCAAGG - Intergenic
1034301266 7:150017358-150017380 AGGGACCTGGAGAAACAGAAGGG - Intergenic
1034804784 7:154079937-154079959 AGGGACCTGGAGAAACAGAAGGG + Intronic
1034880012 7:154756302-154756324 AGGGAGCAGAGGAAGCCGCAAGG - Intronic
1035075440 7:156174543-156174565 GGGGAGCAGAAGGAGAAGAACGG + Intergenic
1035164852 7:156980977-156980999 AGGGAGCAACAGGAGTAGAGTGG - Intergenic
1035339462 7:158151171-158151193 AGGGAGAGGCAGGAGCAGAAAGG - Intronic
1035339489 7:158151281-158151303 AGGGAGAGGCAGGAGCAGAAAGG - Intronic
1035339509 7:158151354-158151376 AGGGAGAGGCAGGAGCAGAAAGG - Intronic
1036587731 8:10140331-10140353 AGAAAGCAGCAGAAGCAGGAAGG - Intronic
1036613197 8:10367661-10367683 AGTGAGTAGCAGAGGCAGATAGG + Intronic
1037252574 8:16913993-16914015 AGGAGGCAGCAGAATCAGCAAGG - Intergenic
1037438194 8:18886898-18886920 AGAGAGCGGCAGAGGCAGACAGG - Intronic
1037655209 8:20877191-20877213 TGGTACCAGCAGAAGCAGAAGGG - Intergenic
1037951935 8:23024240-23024262 AGGAACCGGCAGAAGCTGAAAGG - Exonic
1037974086 8:23197184-23197206 AGGGACCGGCAGAAGCTGAAGGG - Exonic
1038507413 8:28096601-28096623 AGGCAACAGCAGAAGCTGACAGG - Intronic
1038974721 8:32681433-32681455 AAGGTGCAGAAGAAGGAGAAGGG - Intronic
1039456649 8:37711679-37711701 AGGGTGGAGAAGAAACAGAAGGG + Intergenic
1039834657 8:41246900-41246922 AGTGAGGTGCAGAAGCAGCAGGG - Intergenic
1040550091 8:48430920-48430942 AGGGAGCAGAGGAAGGAGATAGG + Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041678652 8:60563599-60563621 AGGGAGTAGCTGAAGCAGGGTGG - Intronic
1041948842 8:63477263-63477285 AAACACCAGCAGAAGCAGAATGG - Intergenic
1042299619 8:67263089-67263111 TGGGAGCAGAGGAAGGAGAAGGG - Intronic
1042357060 8:67839832-67839854 AGAAAACAGCAGAAGCAGAAAGG - Intergenic
1042573005 8:70187126-70187148 AGGCAGCAGGAGAAGCAGTGAGG + Intronic
1042966806 8:74362357-74362379 AGGAATCAACAGAAGGAGAAAGG - Intronic
1043068921 8:75613288-75613310 AGGGTGCACCAGAGGAAGAAAGG - Intergenic
1044172416 8:89071701-89071723 AGGGAGGAGAAGAAGGAAAAGGG - Intergenic
1044386508 8:91595246-91595268 AGGGAGAAACAAAAGCAGCAGGG + Intergenic
1044879452 8:96708169-96708191 AGGGAGAGGCAGAAGAAGAGAGG - Intronic
1044916035 8:97113305-97113327 AGAGAGCAGCAGCAGGAGAAGGG + Intronic
1045716541 8:105053734-105053756 AAGTAGCAGCAGCAGCAGATAGG - Intronic
1045824926 8:106386071-106386093 GGGCAGCAGCAGCAGCAGCAAGG + Intronic
1045890361 8:107148945-107148967 AGGTAGCAAGGGAAGCAGAAAGG - Intergenic
1045911846 8:107419215-107419237 AGGAAACAGCAGAAGCAAGAAGG + Intronic
1046412653 8:113867375-113867397 AAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1046681649 8:117177257-117177279 GGGGTGCTGCAGAAGAAGAAAGG + Intergenic
1046864385 8:119129601-119129623 AGAGAGCAGGAAAAGGAGAAAGG + Intergenic
1047457069 8:125024818-125024840 AGGGGGCACCACAAGCAGAAAGG - Intronic
1047704118 8:127480565-127480587 AGACAACAGCAGCAGCAGAAAGG - Intergenic
1047928609 8:129704441-129704463 AGGGAGGGGCAGAAGGAAAAAGG - Intergenic
1048026049 8:130587846-130587868 AGGATGCAGGAGAAGCAGACAGG + Intergenic
1048417556 8:134243627-134243649 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048737498 8:137518232-137518254 AGGGAGCAGGAGAGGTAGACAGG - Intergenic
1048742148 8:137572981-137573003 AAGGAACAGAAGAGGCAGAAGGG + Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048968775 8:139632432-139632454 AGGAAGCAACAGAAGCAGGTGGG + Intronic
1049055939 8:140237678-140237700 AGGCAGCAGCAAGAGCAGAGCGG + Intronic
1049276840 8:141724248-141724270 AGAGAGCAGCAGGAGCACAGCGG + Intergenic
1049289111 8:141792144-141792166 AGGGTGCAGTAGATGCAGAGAGG - Intergenic
1049365416 8:142234635-142234657 AGGGAGCTGCAGAGGCTGGAGGG - Intronic
1049475166 8:142793916-142793938 GGGGAGCAGGAGATGCCGAATGG + Intergenic
1049681565 8:143920912-143920934 GTGGAGGAGCAGGAGCAGAAGGG - Exonic
1049755133 8:144308069-144308091 AGGGAGCTGCAGATGCAAACAGG - Intronic
1049887880 9:40399-40421 AGGAAGAAGGAGAAGAAGAAAGG - Intergenic
1050010940 9:1185339-1185361 TGGGAGCAGCAGATGCTGAATGG + Intergenic
1050021280 9:1286972-1286994 AAGGAGAAGGGGAAGCAGAAGGG - Intergenic
1050313966 9:4382086-4382108 AGGGAGCTAAAGAAGCAAAAAGG - Intergenic
1050476607 9:6047347-6047369 AGAAAGCAGCAGAAGAAGACCGG + Intergenic
1050506207 9:6352002-6352024 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1050793267 9:9502269-9502291 AGGGCTCAGCAGAGGGAGAAAGG - Intronic
1051111644 9:13645150-13645172 ATGCAACAGGAGAAGCAGAAAGG - Intergenic
1051563863 9:18473897-18473919 AGCGAGCAGCAGAGCGAGAAGGG - Exonic
1051599830 9:18861826-18861848 AGGGAGCAGGAGGAGGAGTAAGG - Intronic
1052721658 9:32178643-32178665 AGGGAGAAGCAGATGTGGAATGG + Intergenic
1052830618 9:33212258-33212280 AGGGAGCAGCAGAAGAAGGGAGG + Intergenic
1053053716 9:34981228-34981250 AGGGAGCAGCAGGACCAGAAAGG - Exonic
1053178315 9:35945516-35945538 AGGGAGCTGCTGAGGCTGAAAGG - Intergenic
1053185153 9:36009722-36009744 ATGAGGCAGGAGAAGCAGAAAGG + Intergenic
1053190732 9:36064763-36064785 AGGGAGAACAAGAAGAAGAATGG - Intronic
1055080256 9:72261704-72261726 AGGAAGAAGAAGAAGAAGAAGGG - Intergenic
1055080644 9:72265115-72265137 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1056164507 9:83928175-83928197 TGGGAGAAGCTGAAGCAGAGAGG + Intergenic
1056293139 9:85164207-85164229 AGGAAACAGCATAAGCCGAAAGG + Intergenic
1056347763 9:85716682-85716704 AGGGGGCATCAGAGGTAGAAGGG - Intronic
1056672547 9:88642827-88642849 AGGGAGGGGGAGAAGGAGAAGGG - Intergenic
1057200701 9:93138276-93138298 AGGGTGCAGCAGAGGAAGCAGGG - Intergenic
1057783495 9:98069633-98069655 AGAAAGCAGCATATGCAGAAGGG + Intronic
1057788845 9:98109224-98109246 AGGGAGCAACAGAGGATGAAGGG + Intronic
1057788851 9:98109251-98109273 AGGGAGCAACAGAGGATGAAAGG + Intronic
1058018294 9:100061922-100061944 AGGAAATAGCAGAAGCAAAAAGG + Intronic
1058508222 9:105688350-105688372 AAGGAGCAGAAGATGAAGAAAGG + Intergenic
1058863894 9:109144126-109144148 AGGCAGCAGGAGAAACAGCAGGG - Intronic
1059073539 9:111165809-111165831 AGAGAGTAGCACCAGCAGAATGG + Intergenic
1059266114 9:113032613-113032635 AGGGAGCAGAAGATGAAGGAAGG + Intergenic
1059608116 9:115858537-115858559 AGGAAGCAACAGATGCTGAAGGG - Intergenic
1059773245 9:117447882-117447904 ATGGGGCAGCCGAAGCAGAGAGG - Intergenic
1060182533 9:121544422-121544444 TGGGTGAAGCAGAAGCAGAATGG + Intergenic
1060347834 9:122832338-122832360 AGGGAGCAGAAAAGGCACAAGGG - Intergenic
1060510072 9:124225200-124225222 AGGGAGGCACAGATGCAGAAAGG + Intergenic
1060987387 9:127827598-127827620 ATGAAACAGCAGCAGCAGAAGGG + Intronic
1061014211 9:127972608-127972630 AGCAAGTAGCAGAAGCAGGATGG + Intronic
1061021840 9:128020773-128020795 AGGGGGAAGGAGAAACAGAAAGG - Intergenic
1061481314 9:130898896-130898918 AGGGAGGAGCAGAGGAGGAAGGG - Intergenic
1061489333 9:130936552-130936574 AGGGAGCAGCAGAGGAAGGCGGG + Intronic
1203656245 Un_KI270753v1:34-56 AGGAATGAGCAGGAGCAGAATGG - Intergenic
1186285032 X:8033978-8034000 GGAGAGCAGCAGAATCAGAGAGG - Intergenic
1186471161 X:9823081-9823103 AGGGAGAAGGAGGAGGAGAAGGG - Intronic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1186471173 X:9823132-9823154 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
1186578731 X:10793969-10793991 AGGGAGCAAGAGAAGGAGAAAGG - Intronic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1187085490 X:16038732-16038754 AGAAAACAGGAGAAGCAGAACGG + Intergenic
1187213256 X:17250309-17250331 AGGGAGCAGCTGAACCAGGCTGG - Intergenic
1187505804 X:19877400-19877422 AGGGGGCAGCAGAGCAAGAATGG + Intronic
1187537857 X:20160031-20160053 AGGGATCAGCACATGCAGATAGG - Intronic
1187968539 X:24636944-24636966 AATGCCCAGCAGAAGCAGAATGG - Intronic
1188034346 X:25300094-25300116 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1188286160 X:28327697-28327719 AGAAAAAAGCAGAAGCAGAAAGG - Intergenic
1188712422 X:33416545-33416567 AGGGTGCAGCAGTAGCAGTTGGG - Intergenic
1188980182 X:36720425-36720447 AAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1189110660 X:38286269-38286291 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189110675 X:38286320-38286342 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189285645 X:39850518-39850540 AAGGAGGAGCAGAAACATAAGGG + Intergenic
1190732932 X:53236474-53236496 GCGGAGCTGGAGAAGCAGAAAGG - Exonic
1190879731 X:54483729-54483751 AGGCAGGAGGAGAAGCAGACCGG - Intronic
1191096183 X:56674710-56674732 AGGGAGAAGCCAGAGCAGAAAGG + Intergenic
1191842384 X:65522496-65522518 GAGGAGCAGGGGAAGCAGAATGG + Intronic
1192034132 X:67545399-67545421 AGGCAGCAGCAGCAGCAGCAGGG + Exonic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192794454 X:74414920-74414942 CGGAAGCAGCAGAAGCATTATGG - Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194320297 X:92438482-92438504 AGAAAACAGCAGAAGCAGGAAGG + Intronic
1194737216 X:97526809-97526831 ACGGAAAAGCAGAAGCAGAGTGG - Intronic
1195112055 X:101658827-101658849 AGGGTGCAGCAAAAGCTGGATGG + Intronic
1195285368 X:103377522-103377544 ATGGAGCAGCCTATGCAGAATGG + Exonic
1195573218 X:106420134-106420156 AGGGAGCATCAGAGTCAGATAGG + Intergenic
1195871773 X:109493876-109493898 AGGGTGCAGCAAAACCACAAGGG + Intergenic
1196054161 X:111336968-111336990 AAGGAGGAGGAGAAGAAGAATGG + Intronic
1196345254 X:114648318-114648340 AGAAAACAGCAGAAGCAGGAAGG - Intronic
1196400636 X:115312534-115312556 TGGGAGCAGCTGAAGCATAGGGG + Intergenic
1196754477 X:119145958-119145980 AGGAAGCATAAGAAGCAGATTGG + Intronic
1196817771 X:119678596-119678618 AATGAGAAGGAGAAGCAGAAAGG - Intronic
1197288129 X:124620589-124620611 AGTGTGCAACAGAATCAGAATGG - Intronic
1198471120 X:136948139-136948161 TGGCGGCAGCAGAGGCAGAAAGG + Intergenic
1198511630 X:137357710-137357732 AGGGACTACCAGAAGCTGAAAGG + Intergenic
1199168091 X:144701488-144701510 AGTTAGCAGAAGCAGCAGAAGGG - Intergenic
1199273010 X:145907510-145907532 AGGGAACAGATGAAGCAAAATGG + Intergenic
1199294488 X:146141725-146141747 AGGTAGCAGAGGAAGGAGAAGGG - Intergenic
1199357608 X:146880073-146880095 AGGGTGCAGCAGATGATGAAGGG + Intergenic
1199467242 X:148152515-148152537 TGGCAGCAGCAAAAGCAGGAAGG - Intergenic
1199707096 X:150437205-150437227 TGCCAGCAGCAGTAGCAGAACGG + Intronic
1199774192 X:150996524-150996546 AGTGAGGAGCAGAAGCAGGTTGG + Intergenic
1200628416 Y:5551612-5551634 AGAAAACAGCAGAAGCAGGAAGG + Intronic
1201487753 Y:14510210-14510232 AAATACCAGCAGAAGCAGAATGG + Intergenic
1201564595 Y:15353177-15353199 AGTGAGCAGCAGAAGCAAGTTGG + Intergenic
1202139028 Y:21701674-21701696 AGGAAAAAGCAGAAGCTGAAGGG - Intergenic