ID: 909345231

View in Genome Browser
Species Human (GRCh38)
Location 1:74577348-74577370
Sequence GGTTGACACAAGTGGCAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909345231_909345234 -6 Left 909345231 1:74577348-74577370 CCTTACTGCCACTTGTGTCAACC 0: 1
1: 0
2: 0
3: 4
4: 91
Right 909345234 1:74577365-74577387 TCAACCTCCAGCTTCCTCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 156
909345231_909345233 -9 Left 909345231 1:74577348-74577370 CCTTACTGCCACTTGTGTCAACC 0: 1
1: 0
2: 0
3: 4
4: 91
Right 909345233 1:74577362-74577384 GTGTCAACCTCCAGCTTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909345231 Original CRISPR GGTTGACACAAGTGGCAGTA AGG (reversed) Intronic
903235061 1:21944800-21944822 TGTAGACAGAAGAGGCAGTAAGG + Intergenic
909345231 1:74577348-74577370 GGTTGACACAAGTGGCAGTAAGG - Intronic
911018800 1:93365464-93365486 GGTTGTCACAACTGGAAGTAGGG - Exonic
918362331 1:183771897-183771919 GGAAGACACAAGTGGCTGGACGG + Intronic
918937428 1:190941049-190941071 GGTTGTTGCCAGTGGCAGTAAGG + Intergenic
919947611 1:202331991-202332013 GGTTCACACAAATGCCAGGATGG + Intronic
1062769376 10:87151-87173 GGTGGACAAGAGTGGCAGCAAGG + Intergenic
1063498461 10:6531384-6531406 GGTTGTCACAAATGGCGGGAGGG + Intronic
1067083292 10:43224984-43225006 TGCTCACACCAGTGGCAGTAGGG + Intronic
1078693512 11:13605857-13605879 GGAAGACACAAGTGACAGAATGG - Intergenic
1082222610 11:49658457-49658479 AGTTGACAGAAATGGAAGTAAGG - Intergenic
1084323669 11:68387049-68387071 GGATGACAGTAGTGACAGTAAGG + Intronic
1085131118 11:74039681-74039703 GGTTGTCACAAGTGGGAGAGGGG + Intronic
1086446331 11:86874820-86874842 GGATGATACAAGTGGCCGAAGGG + Intronic
1089279523 11:117363521-117363543 GGCTGACACATGTGCCTGTAGGG - Intronic
1090080231 11:123607563-123607585 GGTTGGCACAAGTGACTGCATGG + Intronic
1091434400 12:461198-461220 GGTTCAGAAAAGTGGCAGAAGGG - Intronic
1096743440 12:53710915-53710937 GGTTGTCTCAAGTGGGAGTCTGG - Intronic
1102710535 12:114922335-114922357 GGTTGGCACATGTGGCAAGAGGG + Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1112431270 13:99352478-99352500 GGTTGACGCATGTTGCAGCATGG + Intronic
1115483460 14:33885727-33885749 GTATGACCCAAGTGGCAGGATGG - Intergenic
1117378121 14:55134217-55134239 GGTTGTCACAAGTTGGAGTGTGG + Intronic
1118979205 14:70702325-70702347 GGTTGTCACAAGTAGGAGTGGGG - Intergenic
1118980516 14:70712569-70712591 GGTTGTCATAAGTGGAAGTCAGG + Intergenic
1120328325 14:83056209-83056231 AGTAGTCACAAGTGGCAGCATGG - Intergenic
1123926657 15:25119279-25119301 GATTGAGTCAAGTGGCAGCAAGG - Intergenic
1129911281 15:79228811-79228833 GGTTGTCACAACTGGAGGTATGG + Intergenic
1131305277 15:91237353-91237375 GGTTGTCACAACTGGGAGCAGGG - Intronic
1132458492 16:37432-37454 GGTGGACGAAAGTGGCAGTGGGG + Intergenic
1133703033 16:8326692-8326714 AGTAGACACAGGTGGCAGGAGGG - Intergenic
1142191147 16:88718513-88718535 GGTCCACCCACGTGGCAGTATGG - Intronic
1150185268 17:63174022-63174044 GAATGGCACAAGTGGCTGTAGGG - Intronic
1151423497 17:74014439-74014461 GGTTTCCACAATGGGCAGTAGGG - Intergenic
1153148701 18:2064479-2064501 GGTTGTCACAAGAGACAGGAAGG + Intergenic
1154309726 18:13257710-13257732 GGTTGTCACAAGTGGGAGGTGGG + Intronic
1157424884 18:47576549-47576571 GGTTGGCAGAAATGGCATTAAGG + Intergenic
1165508575 19:36251714-36251736 GGTTGTCACAACTGGAAGGAAGG + Intergenic
1167328716 19:48840950-48840972 GGTGGACAGGAGTGGCAGTGAGG - Intronic
1168215237 19:54920297-54920319 GGTTGTCACGAGTTGCAGTGGGG + Intergenic
1168451957 19:56473598-56473620 GGTTGTCACATCTGGGAGTAGGG + Intronic
927212974 2:20650022-20650044 AGGTGACGTAAGTGGCAGTAGGG + Intronic
928340008 2:30434868-30434890 GCTTCTCACAGGTGGCAGTAGGG + Intergenic
929777190 2:44936865-44936887 TGTTATGACAAGTGGCAGTAGGG - Intergenic
931670433 2:64642601-64642623 GGATGACAGAAGTGGTAGTTTGG - Intronic
940904269 2:159154555-159154577 AGTTGAAACAAGGGGCAGGAGGG - Intronic
943553148 2:189366391-189366413 GGTTGTCACAACTGGGAGAAAGG + Intergenic
945118839 2:206437675-206437697 TGTTGTCACAAATGGCAGGATGG - Intergenic
945259896 2:207833674-207833696 GGTTGTCACAACTGGGAGGAGGG - Intronic
1171415697 20:24979225-24979247 GGTAGACTCCAGTGGCTGTAGGG - Intronic
1173575007 20:44107220-44107242 GGTGGCCATAAGAGGCAGTATGG - Intergenic
1178076893 21:29020607-29020629 GGTTGTCACAACTGGAAGGATGG + Intergenic
1179158255 21:38870067-38870089 GGTTACCAGAGGTGGCAGTAGGG - Intergenic
1181574955 22:23787655-23787677 GGTTCCCACAAGTAGCAATACGG - Intronic
1185039955 22:48498736-48498758 GGTTGTCACAACTGGGAGGAGGG - Intronic
950481343 3:13246199-13246221 GGTTCACCCATGTGGCAGTGCGG - Intergenic
950539127 3:13599590-13599612 GGGTGACAGAAGTGGAAGCAAGG + Intronic
950689249 3:14642630-14642652 GGTTGTCACCACTGGAAGTAGGG + Intergenic
952930474 3:38356453-38356475 GGTTGCCACTACTGGCAGGAGGG - Intronic
953587721 3:44220160-44220182 GGTTATCACAAGAGGCAGGAAGG + Intergenic
965217087 3:165876574-165876596 GGTTGACAAAAATGTCATTAGGG - Intergenic
971912451 4:32811251-32811273 GGTTTACAAAAATGGCAGAAGGG + Intergenic
976555512 4:86446722-86446744 GTTTGACAGAAGTATCAGTAAGG - Intronic
978023259 4:103840153-103840175 TGTTGACACACCTGGCAGCAAGG - Intergenic
978437007 4:108696343-108696365 GGATGACGCAAGTGACAGCAAGG + Intergenic
984531003 4:180916257-180916279 TGATCACAGAAGTGGCAGTAAGG + Intergenic
984715413 4:182919832-182919854 GGTTGTAAGAAGTGGGAGTAGGG - Intergenic
985027427 4:185751957-185751979 GGTTGCCACAGCTGGCAGTGGGG + Intronic
985961218 5:3304678-3304700 GGCCGACACAGGTGGCAGCAAGG + Intergenic
1004248047 6:13999207-13999229 TGTTGACACAAGTAGCTGTGTGG + Intergenic
1008628217 6:53338283-53338305 GGATGTGACAAGTGACAGTAAGG - Intronic
1009344667 6:62598256-62598278 GTTAGAAACAAGTAGCAGTAGGG + Intergenic
1009886288 6:69627912-69627934 TTTTGACACATGTGGCAGGATGG - Intergenic
1011576077 6:88800842-88800864 GGTTGTCACAAATGGGAATAGGG + Intronic
1013668507 6:112372958-112372980 GATGGATAAAAGTGGCAGTATGG + Intergenic
1025870692 7:65430842-65430864 GTTTCACACAAGTGTCAGTCAGG - Intergenic
1026019159 7:66694668-66694690 GGGTGAAGCCAGTGGCAGTAGGG + Intronic
1027623647 7:80522447-80522469 GGTTGGCACAAGTGGGAAAAAGG + Intronic
1027661979 7:80998140-80998162 GGTTGATATAATTGGCAGCATGG - Intergenic
1029537821 7:101166364-101166386 CCTTGACACAAGCGGCAGTCAGG - Intergenic
1030372798 7:108719449-108719471 GGATGAGAGAAGTGGCAGTGGGG - Intergenic
1031743571 7:125466583-125466605 GGTAGACACAAAAGTCAGTAAGG - Intergenic
1038827257 8:31017933-31017955 GAATGACACAAGAGGCAATAGGG - Intronic
1043925104 8:86027878-86027900 GGATGAGACAAGTAGCAGTACGG - Intronic
1045682204 8:104674376-104674398 GGAAGACACAAGTGCCAGTAAGG - Intronic
1047975097 8:130122015-130122037 GGGTGCCCCAAGGGGCAGTAAGG - Intronic
1050116904 9:2272343-2272365 GGTTAACGTAATTGGCAGTAAGG - Intergenic
1052987681 9:34500128-34500150 GGTTTAGACAAGTGGGAGGATGG + Intronic
1055468640 9:76590276-76590298 GGTTGTCACAACTGGGAGGAAGG - Intergenic
1055883680 9:81033256-81033278 GGCTGACACATGTGGCAGGAAGG + Intergenic
1056150072 9:83777135-83777157 GGTTGTCAAAGGTGGCAGTGGGG - Intronic
1056553141 9:87667404-87667426 GGTTGTCACAACTGGGAGTTAGG + Intronic
1058281137 9:103115918-103115940 TGTTGACACCAGTGGGGGTAAGG - Intergenic
1188179195 X:27033270-27033292 GATTGAGTCAAGTGGCAGCAAGG + Intergenic
1196369392 X:114959078-114959100 GGTTGCTATAAGGGGCAGTAAGG - Intergenic
1196757758 X:119172705-119172727 GGATGGCAGAAGTGGGAGTAGGG + Intergenic