ID: 909346162

View in Genome Browser
Species Human (GRCh38)
Location 1:74590021-74590043
Sequence CCTCACTGTCACTAGAATAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 146}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909346156_909346162 -5 Left 909346156 1:74590003-74590025 CCCCCACTGCAGATTCATCCTCA 0: 1
1: 0
2: 1
3: 19
4: 220
Right 909346162 1:74590021-74590043 CCTCACTGTCACTAGAATAAGGG 0: 1
1: 0
2: 0
3: 17
4: 146
909346155_909346162 0 Left 909346155 1:74589998-74590020 CCTGTCCCCCACTGCAGATTCAT 0: 1
1: 0
2: 0
3: 7
4: 207
Right 909346162 1:74590021-74590043 CCTCACTGTCACTAGAATAAGGG 0: 1
1: 0
2: 0
3: 17
4: 146
909346157_909346162 -6 Left 909346157 1:74590004-74590026 CCCCACTGCAGATTCATCCTCAC 0: 1
1: 0
2: 0
3: 30
4: 332
Right 909346162 1:74590021-74590043 CCTCACTGTCACTAGAATAAGGG 0: 1
1: 0
2: 0
3: 17
4: 146
909346159_909346162 -8 Left 909346159 1:74590006-74590028 CCACTGCAGATTCATCCTCACTG 0: 1
1: 0
2: 2
3: 114
4: 938
Right 909346162 1:74590021-74590043 CCTCACTGTCACTAGAATAAGGG 0: 1
1: 0
2: 0
3: 17
4: 146
909346158_909346162 -7 Left 909346158 1:74590005-74590027 CCCACTGCAGATTCATCCTCACT 0: 1
1: 0
2: 3
3: 28
4: 217
Right 909346162 1:74590021-74590043 CCTCACTGTCACTAGAATAAGGG 0: 1
1: 0
2: 0
3: 17
4: 146
909346154_909346162 1 Left 909346154 1:74589997-74590019 CCCTGTCCCCCACTGCAGATTCA 0: 1
1: 0
2: 2
3: 23
4: 289
Right 909346162 1:74590021-74590043 CCTCACTGTCACTAGAATAAGGG 0: 1
1: 0
2: 0
3: 17
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909346162 Original CRISPR CCTCACTGTCACTAGAATAA GGG Exonic
902138212 1:14329303-14329325 CATCACTGTGACTAGAGAAAGGG + Intergenic
902309895 1:15574184-15574206 CCACCCTGTCACTAGACTACAGG + Intronic
903533999 1:24054490-24054512 CCTCACTGTCACATCACTAAAGG + Intergenic
906506221 1:46381858-46381880 CCTCAGTTTCCCTAGAAAAAGGG - Intergenic
909346162 1:74590021-74590043 CCTCACTGTCACTAGAATAAGGG + Exonic
909712674 1:78670025-78670047 ACTCACTGACATTAGAATAATGG - Intergenic
910046782 1:82927030-82927052 CCTGTCTCTCACTAGAATTATGG + Intergenic
911616641 1:100019811-100019833 TCTAACAGTCAATAGAATAAAGG - Intronic
912222238 1:107691174-107691196 GTTCACTGACACTAAAATAATGG + Intronic
913379182 1:118189585-118189607 CACCACTTTCCCTAGAATAATGG - Intergenic
915590335 1:156866841-156866863 CCTCACTCTGACCAGAATGAGGG - Intronic
916829113 1:168473277-168473299 ACTCACTATCACAAGAACAAAGG - Intergenic
919147844 1:193657555-193657577 CCTCAGTGTCACAAGAAGTAAGG + Intergenic
919772183 1:201169375-201169397 ACTCATTTTCTCTAGAATAAGGG + Intronic
922125480 1:222716823-222716845 ACTCACTATCACTAGCACAAAGG - Intronic
1067907436 10:50308177-50308199 CCTTAATGTCATTTGAATAATGG - Intronic
1069418440 10:68223836-68223858 CCTCACAGGAACTACAATAAGGG - Intergenic
1071613878 10:87056747-87056769 CTACACCGTCACTAGAATAAAGG + Intronic
1073074188 10:100813267-100813289 CCTCTCTGTGACTAAAACAAGGG - Intronic
1080590979 11:33722932-33722954 CCTCACTGTAAGAAGTATAATGG + Intronic
1081729119 11:45356020-45356042 TTTCACTGTCACTTCAATAAAGG - Intergenic
1085023350 11:73222487-73222509 CCTCAGTGTCCTTAGAATAGAGG + Intronic
1086333935 11:85781295-85781317 ACTCACTGTCACTAGAACAGCGG + Intronic
1087416658 11:97864851-97864873 GCTCACTTTCTCTAGAATTAAGG - Intergenic
1087864663 11:103209042-103209064 ACTCTCTGTCACAAGAATTATGG + Intronic
1091152777 11:133344189-133344211 CCTCACTCCTGCTAGAATAAGGG + Intronic
1095121753 12:38427202-38427224 AATCAATGTCAATAGAATAAAGG + Intergenic
1095189402 12:39239004-39239026 CCACACTGTCACTCAAACAAAGG + Intergenic
1095239996 12:39846770-39846792 CCTCAGTGTCACTGGTAAAATGG + Intronic
1097274092 12:57799875-57799897 GCTCACTGTCATTAGAATTCAGG + Exonic
1097410200 12:59243133-59243155 TTTCACTGTCATTGGAATAAGGG + Intergenic
1097423200 12:59407930-59407952 CCTCCCTGTGGCTAGAATGAAGG + Intergenic
1097699587 12:62806578-62806600 ACTCACTGTCACAAGAACAAGGG - Intronic
1098860715 12:75707052-75707074 CCTCACTTTCATAAGCATAAAGG + Intergenic
1099539663 12:83891618-83891640 CCTCAATGTCACTATAAAAGTGG - Intergenic
1099973881 12:89526015-89526037 CCTCCCGGTCACTACAACAACGG + Exonic
1101797194 12:107986096-107986118 ACTCCCTGTAACTAGAATAAAGG + Intergenic
1107748247 13:43535919-43535941 CGTCACATTCACTAGAATAATGG + Intronic
1111830157 13:93318923-93318945 CCTCATTCTGACTAGAGTAAGGG - Intronic
1112426695 13:99308788-99308810 CCTCACTGTGTATAAAATAAAGG + Intronic
1113616377 13:111683549-111683571 CCTCACTGTCACCAGAGAACAGG - Intergenic
1113621845 13:111768442-111768464 CCTCACTGTCACCAGAGAACAGG - Intergenic
1117827347 14:59717590-59717612 CCACAATGCCACTAGAACAAAGG - Intronic
1118397493 14:65349834-65349856 CCTGCCTTTCACTAGAAAAAGGG + Intergenic
1121676475 14:95757398-95757420 CCTCCCTGTAACCAGAAGAAAGG + Intergenic
1122676954 14:103423518-103423540 CCCCACAATCACTGGAATAAAGG + Intronic
1123634077 15:22285795-22285817 AGTCACTGAGACTAGAATAATGG + Intergenic
1127377251 15:58396495-58396517 ACTCACTGTCATGAAAATAAAGG - Intronic
1127519439 15:59728645-59728667 CCTCACTACGACTAGAATACAGG + Intergenic
1131305755 15:91241674-91241696 CTCCACTGTCACAAGAATACGGG - Intronic
1132436351 15:101807370-101807392 ACTCACTATCACGAGAACAACGG - Intronic
1133257157 16:4524048-4524070 CTTGACTGTCAATAGAATATTGG + Intronic
1133888556 16:9855528-9855550 CCTCACTGTAACAGGAATGAGGG + Intronic
1135302615 16:21344020-21344042 CTAAACTGTCCCTAGAATAAAGG + Intergenic
1135512725 16:23101208-23101230 CGTCAGTGGCAGTAGAATAAAGG + Intronic
1136299376 16:29323236-29323258 CTAAACTGTCCCTAGAATAAAGG + Intergenic
1137873051 16:51969161-51969183 CCTTAGTGTCACCAAAATAAAGG - Intergenic
1137889096 16:52139768-52139790 GCTCAGTGTGACTCGAATAAGGG - Intergenic
1140620443 16:76723566-76723588 CCTTGCTGGCACAAGAATAAAGG - Intergenic
1148259169 17:46164816-46164838 CCTCACTTTAATTAGAAAAATGG + Intronic
1156296528 18:35796976-35796998 TCCCACTTTCAATAGAATAAAGG - Intergenic
1162604384 19:11695339-11695361 CCACACTGCAACAAGAATAAGGG + Intergenic
1163366123 19:16877004-16877026 CCTCACTGTCACCAGGATGCGGG - Intronic
1164532036 19:29056068-29056090 GGTCACTGTTACTAGAAGAATGG - Intergenic
927735064 2:25512951-25512973 CCTCACTGCCTGTAGAATGAAGG - Intronic
929251073 2:39756249-39756271 CCTTATTGTCATTACAATAAGGG - Intronic
930021028 2:47002338-47002360 CCTCACTGTTCTTAGAATAATGG - Intronic
930092823 2:47543775-47543797 CCCCACTGTCACTATAATTCTGG + Intronic
930230878 2:48842722-48842744 TATCACTGTCAGTAGAATGAAGG + Intergenic
930508456 2:52314347-52314369 CCTCAATGTCATTAAAATAAAGG + Intergenic
931258536 2:60596668-60596690 CCTCACTATCACGAGAACAACGG - Intergenic
932276431 2:70455278-70455300 CCTCACTGTTACCAGAACCAGGG + Intronic
932576219 2:72963736-72963758 CCTCCCTGGCACTGGAATGAAGG - Intronic
933703235 2:85271062-85271084 CGACACTGGCACTAGAATATAGG - Intronic
934108205 2:88715840-88715862 CCTCTCTGAAACTACAATAAAGG - Intronic
939666480 2:144958780-144958802 TCTCACTCTTAATAGAATAAAGG + Intergenic
940886394 2:158993018-158993040 CCTCTTTGTCATTAGAATCAGGG + Intronic
943615327 2:190085710-190085732 CCTCACTGTCAATGGAAAATAGG + Intronic
944620328 2:201507927-201507949 ACTCACTGTCACCAGAACAAGGG + Intronic
946912411 2:224477369-224477391 ACTCACTGTTCCTAAAATAAGGG + Intronic
947917154 2:233840003-233840025 CCCCACTGTCTCTAGAGAAAAGG + Intronic
948886490 2:240887641-240887663 CCTCACTGCCACTAGGACACAGG + Intronic
949053305 2:241909385-241909407 CCTCAGTGTTACTGGAAAAAGGG + Intergenic
1170467808 20:16638860-16638882 CCTCACTGTGACTGGAGTCATGG + Intergenic
1172123710 20:32613024-32613046 CCTTACTGTCCCTGGAACAATGG + Intergenic
1174193743 20:48758263-48758285 CCTGTCTGTCACTAGTTTAAGGG + Intronic
1174892200 20:54407810-54407832 CCTCATTGTCTCAAGAATGAGGG + Intergenic
1175304420 20:57966104-57966126 CCTCATTTTCACTAGAATTCTGG - Intergenic
952113748 3:30155102-30155124 CCTCACTATCCTTAAAATAAGGG + Intergenic
952270379 3:31825099-31825121 CCCCACTGTCCATAGGATAAAGG - Intronic
953669592 3:44951537-44951559 CCTCACTGTCCCTGGACTCACGG + Intronic
955701173 3:61683713-61683735 CTTCACCGTCACTTGAATATTGG + Intronic
956013815 3:64859889-64859911 CATCTCTCTCACTAGAAAAATGG + Intergenic
956769516 3:72512863-72512885 GCACTCTGTCACTAGAATATAGG - Intergenic
957957315 3:87204877-87204899 CCTAAATGTCAGTAGAGTAAAGG - Intergenic
958878818 3:99645954-99645976 CCTCCCTGTCAGTGGAGTAAGGG + Intronic
960419359 3:117425042-117425064 CCCCACTGGCACTAGAATATGGG - Intergenic
962393035 3:134989607-134989629 CTTCACTGTAACTAGAAAGATGG + Intronic
964265775 3:154893971-154893993 ACTCACTATCACGAGAACAAGGG + Intergenic
965514867 3:169610292-169610314 CCTCAGTGGCACTGGAATCATGG + Intronic
965906963 3:173720350-173720372 CCTTCCGGTCACTTGAATAAGGG - Intronic
966927206 3:184652514-184652536 TCTCCCTGTCACCAGACTAATGG + Intronic
969535460 4:7754002-7754024 ACTCACTATCACGAGAATAACGG - Intergenic
970171673 4:13296770-13296792 CCTCAGTCTCCCTATAATAAGGG + Intergenic
973809125 4:54553105-54553127 AATAACTGTCACTAGAAAAATGG + Intergenic
976565096 4:86543909-86543931 CCTCACTGTAACTAGCAGTAAGG + Intronic
977959279 4:103067302-103067324 CCTACCTGTAACTAGAAAAATGG - Intronic
978890639 4:113822361-113822383 CTCCACTGTAACAAGAATAATGG + Intergenic
979958242 4:126982111-126982133 CTTCACTCTCTCTAGAATCACGG - Intergenic
983174806 4:164576021-164576043 CCTCACTGGTCCTAGAATACAGG - Intergenic
983317537 4:166151242-166151264 CCTCACTTTCACTAGATGTAAGG + Intergenic
984151989 4:176144414-176144436 CCTCACTGTGCCTTGAAAAAAGG + Intronic
984816994 4:183848256-183848278 TTTCACTGTCATTAGAATATTGG + Intergenic
985509426 5:304189-304211 CCTGACAGTCACTGGATTAAAGG - Exonic
985738850 5:1602701-1602723 CCTGACAGTCACTGGATTAAAGG + Intergenic
986710729 5:10486313-10486335 CCTCTCTGTAGGTAGAATAATGG + Intergenic
989675928 5:43972527-43972549 CCTCAGTGTGACTAGAACAGAGG - Intergenic
990321082 5:54630485-54630507 CTTCACTCTCAGTAGAATCAAGG - Intergenic
991119055 5:62989932-62989954 TCTCACTGTCATGAGAACAAGGG + Intergenic
996490909 5:124095001-124095023 CCACAGAGTCAATAGAATAAAGG - Intergenic
998479071 5:142446157-142446179 ACTCACTATCACAAGAACAAGGG + Intergenic
1001992128 5:176126243-176126265 CATTACTGTTACAAGAATAATGG - Intronic
1002224746 5:177711922-177711944 CATTACTGTTACAAGAATAACGG + Intronic
1002862015 6:1087789-1087811 CCTCAATGTTTCTAGAACAATGG - Intergenic
1003644972 6:7907424-7907446 CCTCACTGTCACCAGGTTCAGGG + Intronic
1004743312 6:18485007-18485029 CCACACAGTCATTAGAATAAGGG + Intergenic
1005265377 6:24106975-24106997 CCTCACTGCCAGAGGAATAAAGG + Intergenic
1007057262 6:38899280-38899302 CCCCACTGTAAATAGAATTATGG + Intronic
1008296756 6:49787310-49787332 CCTCACTGTCTCCAGCACAACGG + Intergenic
1015194877 6:130514812-130514834 TCACACTATAACTAGAATAAAGG - Intergenic
1015200886 6:130579029-130579051 CCTCACTGTCACTAGCCTAGAGG - Intergenic
1016883142 6:148931040-148931062 CCTCACTGAAAATAGTATAAAGG - Intronic
1017129647 6:151096927-151096949 CTTCACTGTGGTTAGAATAAGGG + Intronic
1017422490 6:154286972-154286994 ACTCACTGTCATGAGAACAAGGG - Intronic
1017670313 6:156764332-156764354 GCTCAATTTCCCTAGAATAATGG + Intergenic
1020460777 7:8427259-8427281 CCTCACTGTTACCTGAATGATGG - Intergenic
1021074847 7:16289549-16289571 CATCACTATCAACAGAATAAAGG + Intronic
1022735416 7:33071250-33071272 ACTCACTGTCACAAGAATAGGGG - Intergenic
1023022337 7:36021581-36021603 CCTCACTTTCACTAGGACTATGG + Intergenic
1023442096 7:40194753-40194775 CATTACTGTCAGTAAAATAATGG - Intronic
1026433417 7:70370859-70370881 CTTCACACCCACTAGAATAATGG - Intronic
1029381761 7:100219794-100219816 CCTCACTGTCACTTTAAGAAGGG + Exonic
1029401926 7:100352244-100352266 CCTCACTGTCACTTTAAGAAGGG + Exonic
1030951431 7:115794567-115794589 CCTCACTGTCATTACAACATTGG + Intergenic
1033287090 7:140050480-140050502 CCCCACCATCACTAGAATGAGGG + Intronic
1034232718 7:149545118-149545140 CCACAGTGTCACTGAAATAATGG + Intergenic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1038301059 8:26349142-26349164 CCTTTCTGTCACTAAAACAATGG + Intronic
1038560834 8:28578112-28578134 AATCTCTGTCACTATAATAAGGG - Intergenic
1041492494 8:58450120-58450142 CATCACTTTCTCTAGAGTAAAGG + Exonic
1048147864 8:131863043-131863065 CCCCACTCTCATTAGAATATAGG + Intergenic
1051317450 9:15856948-15856970 CCTCAATGTCACTATCATCAAGG - Intronic
1051832231 9:21292744-21292766 CATCACTGTCACAAGAAGCAAGG + Intergenic
1051841089 9:21399105-21399127 CCTCAGTGTCACTAGTGAAAAGG + Intergenic
1052392374 9:27895293-27895315 CCTAACTGTTAATAGAAAAATGG - Intergenic
1055190625 9:73517751-73517773 CTTTACTGTTTCTAGAATAATGG + Intergenic
1057982843 9:99679585-99679607 CTTCTCTGTGACCAGAATAAAGG - Intergenic
1058785783 9:108385418-108385440 CCTCACTATCTATAAAATAAAGG + Intergenic
1060171915 9:121468894-121468916 CCTCACAGTCACGAGATAAAAGG - Intergenic
1190131295 X:47751271-47751293 CCTCACTGTTATTAGAAAAGAGG - Intergenic
1195658417 X:107355340-107355362 AATCACTGTCACTAGGAGAATGG + Intergenic
1199479578 X:148283506-148283528 CCTCACTGTCACGAGTTCAATGG + Intergenic
1202305455 Y:23465463-23465485 AGTCACTGAGACTAGAATAATGG + Intergenic
1202565354 Y:26205126-26205148 AGTCACTGAGACTAGAATAATGG - Intergenic