ID: 909350015 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:74640919-74640941 |
| Sequence | GTCCCATTTTGCTACATTGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 909350013_909350015 | 10 | Left | 909350013 | 1:74640886-74640908 | CCAGAGGTCAGAAAATATAGAAT | 0: 1 1: 1 2: 0 3: 21 4: 376 |
||
| Right | 909350015 | 1:74640919-74640941 | GTCCCATTTTGCTACATTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 909350015 | Original CRISPR | GTCCCATTTTGCTACATTGA AGG | Intronic | ||