ID: 909350015

View in Genome Browser
Species Human (GRCh38)
Location 1:74640919-74640941
Sequence GTCCCATTTTGCTACATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909350013_909350015 10 Left 909350013 1:74640886-74640908 CCAGAGGTCAGAAAATATAGAAT 0: 1
1: 1
2: 0
3: 21
4: 376
Right 909350015 1:74640919-74640941 GTCCCATTTTGCTACATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909350015 Original CRISPR GTCCCATTTTGCTACATTGA AGG Intronic