ID: 909350807

View in Genome Browser
Species Human (GRCh38)
Location 1:74651319-74651341
Sequence GAAACCAAGGTGCCACATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909350804_909350807 12 Left 909350804 1:74651284-74651306 CCTCAAAAGAGACTGAAAAGCAG No data
Right 909350807 1:74651319-74651341 GAAACCAAGGTGCCACATGAGGG 0: 1
1: 0
2: 0
3: 17
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909350807 Original CRISPR GAAACCAAGGTGCCACATGA GGG Intronic
900915260 1:5633004-5633026 GAAGCCAAGGTGACACAGGATGG - Intergenic
900999076 1:6138601-6138623 CAAACCCAGGTGCCACGTGCAGG - Intronic
901087945 1:6623110-6623132 GGCACAAAGGTGCCACATGAAGG - Exonic
901272723 1:7965452-7965474 GAAACAAAGAAGCCATATGAAGG - Intronic
902852000 1:19166188-19166210 CAAATGAAGGTGCCACATGTTGG - Intronic
904707279 1:32400991-32401013 GACACCCAGGTGCCACCAGATGG + Intergenic
906689548 1:47783599-47783621 GAAGCCAGGGTCCCACATAAAGG + Intronic
907038227 1:51235761-51235783 GAAGCCAAGGTGAGAGATGATGG + Intergenic
907488215 1:54791620-54791642 GACAGCAGGGTGCCACAGGATGG - Intronic
908236483 1:62152023-62152045 GAAACCAAGGTGAAACAAAATGG - Intronic
909350807 1:74651319-74651341 GAAACCAAGGTGCCACATGAGGG + Intronic
910155608 1:84215064-84215086 GAGACCAATATGCCACAAGAAGG - Intronic
910465918 1:87499847-87499869 GAAGGCAATGTGCAACATGAGGG - Intergenic
910534487 1:88281160-88281182 ACATCCAAGTTGCCACATGAAGG - Intergenic
913570638 1:120116608-120116630 GAAACCAAGGCACAAAATGATGG + Intergenic
914291446 1:146277587-146277609 GAAACCAAGGCACAAAATGATGG + Intergenic
914552490 1:148728370-148728392 GAAACCAAGGCACAAAATGATGG + Intergenic
919206000 1:194422532-194422554 AAGACCAAGATCCCACATGAAGG + Intergenic
924880899 1:248161506-248161528 GAAATCAATTTGACACATGAGGG + Intergenic
1064280894 10:13950679-13950701 GAAACGAATGTGGCACATGGTGG - Intronic
1064306069 10:14167739-14167761 GCATCCATGCTGCCACATGAAGG + Intronic
1066748782 10:38631451-38631473 GACACCAAGTTGCCACCTGGTGG + Intergenic
1066967883 10:42286335-42286357 GACACCAAGTTGCCACCTGGTGG - Intergenic
1067777197 10:49172273-49172295 GAGACCCAAGTGCCCCATGAAGG + Intronic
1067829574 10:49602697-49602719 AAAACCAAGGAGACAGATGAAGG - Intergenic
1072443106 10:95474725-95474747 TAAAACATGCTGCCACATGAGGG - Intronic
1072738846 10:97897306-97897328 GAAACCCAGGGGCCACTTGAAGG - Intronic
1072853872 10:98925918-98925940 GAACCCAAGGAACAACATGATGG - Intronic
1073025911 10:100487220-100487242 GAAACAAAAGACCCACATGATGG + Exonic
1075441155 10:122480317-122480339 GAACCCCAGTTGCCACATCAGGG + Intronic
1077054534 11:584531-584553 GAATCCAAGCTGCCACCTGAGGG + Intronic
1078625013 11:12947459-12947481 GATACTAGGATGCCACATGAGGG - Intergenic
1078629954 11:12993221-12993243 GAAACCAAGGAGGCACATTTGGG - Intergenic
1091582924 12:1799738-1799760 GAAAACATGGTGGCACATGAGGG + Intronic
1092671664 12:10868475-10868497 GAATCCAAGGTGTCACATGCAGG - Intronic
1092728769 12:11509035-11509057 CAGACCAAGGGGCCACATGTTGG + Intergenic
1093495737 12:19755004-19755026 TAAAATCAGGTGCCACATGACGG - Intergenic
1096899201 12:54856921-54856943 GGAATCAAGGAGCCACATAAAGG - Intronic
1096973213 12:55683865-55683887 GAAAACTTGCTGCCACATGAAGG - Exonic
1098289135 12:68938467-68938489 GAAACAAATGTGCCACATTAGGG - Intronic
1102482311 12:113232316-113232338 GGGACCAGGGTGCCACATGGGGG - Intronic
1104293946 12:127495001-127495023 AAAACCAAGATGCCCCAGGAAGG + Intergenic
1104650030 12:130524847-130524869 GAAAAGAAGGTGCCACATTCTGG + Intronic
1107448560 13:40488932-40488954 GAAGGCAAGTTGCCACGTGAGGG + Intergenic
1109314188 13:60730668-60730690 GAAACTATGATGCCCCATGAGGG - Intergenic
1109931750 13:69225381-69225403 CAAAGCATGGTGCCATATGAAGG - Intergenic
1110057273 13:70988647-70988669 TACACTAAGGTGGCACATGAAGG - Intergenic
1111184163 13:84709171-84709193 AAAATCAAGGTGCCAAATCAAGG - Intergenic
1111781352 13:92729813-92729835 GAAAACAAGGTGCCACACACTGG - Intronic
1115286335 14:31717074-31717096 AAAAACAAGGTGCCACAAAAGGG - Intronic
1117105983 14:52397522-52397544 GAAACTAATGTGCCACCTGTGGG + Intergenic
1118475241 14:66110076-66110098 GAAACCAAGGTGGAGAATGACGG + Intergenic
1118554387 14:66998692-66998714 TAAACCAATGTGCTACATTAGGG - Intronic
1121063605 14:90939836-90939858 GAAACCAAGGAGGCAGATTAGGG + Intronic
1121221019 14:92285416-92285438 GAAAACCAGGTGCCCCGTGAGGG - Intergenic
1127542687 15:59957322-59957344 GAAACTAAGGTGAAACAAGAAGG + Intergenic
1128407520 15:67358185-67358207 GAAAAGAAAGTGCCTCATGATGG - Intronic
1133190772 16:4132130-4132152 GATACCAGGGTGCAACATGCTGG + Intergenic
1137627578 16:49919359-49919381 GAAAGCAAGACGCCACCTGAAGG - Intergenic
1138594835 16:58024489-58024511 GAAACCAACTTCCCAGATGAAGG + Intergenic
1203019104 16_KI270728v1_random:383756-383778 GACACCAAGTAGCCACATGGTGG + Intergenic
1203037439 16_KI270728v1_random:656914-656936 GACACCAAGTAGCCACATGGTGG + Intergenic
1145945125 17:28768175-28768197 GAAACCAAGGTGGCAAATTATGG + Intronic
1146486193 17:33244846-33244868 TAAAACAAGGTGGCACATGTTGG + Intronic
1146628385 17:34452288-34452310 GACACCAAGGTGCCCAATTAAGG - Intergenic
1148209402 17:45799152-45799174 GAGAAAAAGGTGCCCCATGAGGG + Intronic
1149157369 17:53647903-53647925 GATACCCAGGTGCTACATTAAGG - Intergenic
1149412795 17:56426194-56426216 GTAACCAAGGTGGGACAGGAAGG - Intronic
1149529600 17:57384273-57384295 GAAATCAAGGGGAGACATGATGG + Intronic
1151884132 17:76913489-76913511 GAAACAGAGGTGCCCCATGGAGG + Intronic
1152375923 17:79919028-79919050 GAAGCCAGGGAGCCACATGCTGG - Intergenic
1156368573 18:36451950-36451972 GAAAAAAAGGAGCCACATGCAGG - Intronic
1157093121 18:44660116-44660138 GACACCAAGGTGTCTAATGATGG - Intergenic
1159186358 18:64980212-64980234 GAAACAAAGTTACCACATGTAGG - Intergenic
1159871514 18:73763603-73763625 GAAACTGGGCTGCCACATGAAGG + Intergenic
1160899279 19:1419135-1419157 GAACCCAAGTTGCCACGTCAGGG - Intronic
928403631 2:30997274-30997296 GAGCCCAAAGTGCCACAGGAGGG + Intronic
928432377 2:31231709-31231731 GAAATCAAGGGGCCCCATTATGG - Intronic
932570472 2:72935821-72935843 GAAACCTAGCTGCAACATGGAGG - Intronic
933915206 2:86984381-86984403 GGAACCAAGATGCCATCTGATGG - Intronic
934007787 2:87785519-87785541 GGAACCAAGATGCCATCTGATGG + Intronic
934289282 2:91677430-91677452 GAAGCCAAGTTGACATATGAAGG + Intergenic
934947240 2:98550629-98550651 AAAACCAGGCAGCCACATGAGGG - Intronic
935515076 2:104026619-104026641 GAGACCAAAGTGCCACAAAAGGG - Intergenic
935769430 2:106402752-106402774 GAAACACAGATGCCACAAGAAGG - Intronic
935908650 2:107869511-107869533 GGAACCAAGATGCCATCTGATGG - Intronic
935968782 2:108510027-108510049 GAAACACAGATGCCACAAGAAGG + Intergenic
935995053 2:108761726-108761748 GGAACCAAGATGCCATCTGATGG - Intronic
945297240 2:208182860-208182882 CAAATCAAAGTGCCTCATGATGG + Intronic
945950549 2:216035050-216035072 GAGACCAATGGGCCACAGGACGG + Intronic
946378352 2:219327900-219327922 GAAGCCCAGCTGCCACATTATGG + Intronic
1169743771 20:8922316-8922338 AACTACAAGGTGCCACATGATGG - Intronic
1170280767 20:14645640-14645662 CAAACCAAAGTGCTACATTATGG - Intronic
1171103363 20:22407786-22407808 GCCTCCAAGGAGCCACATGAGGG + Intergenic
1173368524 20:42412758-42412780 GACAGCAAGATGCCTCATGAAGG + Intronic
1175530225 20:59669748-59669770 GAAAACATGATGCCAAATGAAGG - Intronic
1178357058 21:31918371-31918393 GGAATCAAGGTGTCAGATGATGG + Intronic
1179048573 21:37869187-37869209 CAATCAAAGGTGCCTCATGATGG - Intronic
1181095786 22:20504361-20504383 GAAAGTAAGGGGCCACAGGAAGG - Intronic
1181968594 22:26673309-26673331 GAAACCAAGGTGCCTACTGGAGG - Intergenic
1184308671 22:43627106-43627128 CACACCAAGGAGCCACCTGAAGG + Intronic
1185325762 22:50225190-50225212 GAAACCAAGAGGCCTCAAGAGGG + Intronic
952015453 3:28951287-28951309 GATACCAAGGTACCACATTTTGG + Intergenic
954954117 3:54504080-54504102 AAAACAAAGGTACCACATCAGGG - Intronic
961449435 3:126995809-126995831 GAAACCAAGGCCCCAGAGGATGG - Intronic
964490581 3:157231549-157231571 GATACCAAGACTCCACATGAAGG + Intergenic
965476923 3:169167451-169167473 GAACTCAAGGTCCCGCATGATGG + Intronic
966497280 3:180595489-180595511 GAAATCAAGGGGCCCCATTATGG + Intergenic
967109111 3:186277709-186277731 GAAAGGAAAGAGCCACATGATGG - Intronic
967222024 3:187255432-187255454 GAAATCAAGGTGTCAGCTGATGG - Intronic
970232650 4:13926911-13926933 GAAATCAAGGTCACACATTAGGG + Intergenic
971792220 4:31184395-31184417 AAAACAAAGGTGCCACATGGTGG + Intergenic
972902383 4:43700726-43700748 GATACCCAGGTGCTACATCAAGG - Intergenic
977427900 4:96892197-96892219 CAAACCAAGGTGCAACAAGTGGG + Intergenic
979854993 4:125621482-125621504 GAGACCAAACTGACACATGATGG + Intergenic
982225557 4:153162827-153162849 GAACCCAAGATGCCACCTGAGGG + Intronic
986041154 5:3995245-3995267 GACACCAAGGAGCCGGATGAAGG - Intergenic
987212416 5:15696333-15696355 GAAGCCAAGGTGTAATATGAGGG - Intronic
992039251 5:72813171-72813193 GAACCCAAGGAACAACATGATGG - Intergenic
993371246 5:87095289-87095311 GAAAACTAGAAGCCACATGAAGG + Intergenic
995027906 5:107445802-107445824 AAAAGCCAGGTGCCACAAGAAGG - Intronic
1000189365 5:158894507-158894529 GAAACTAATCTGCCACTTGATGG - Intronic
1000918973 5:167116349-167116371 GAAACCCATGTCCCACAGGAAGG + Intergenic
1003515143 6:6811626-6811648 GAATCCCAGGTGGCACAGGATGG + Intergenic
1006238479 6:32657109-32657131 AAAAGCAAGAAGCCACATGAAGG + Intergenic
1011661010 6:89593893-89593915 GCTCCCAAGGTGCCACATCAAGG - Intronic
1012748626 6:103127508-103127530 GAAACCAAGAACCCACAGGAAGG - Intergenic
1013346116 6:109262307-109262329 GAAACCCAGGTGCCAGTAGAAGG - Intergenic
1014208175 6:118679679-118679701 GAAACAAAGGGCCCACTTGAGGG + Intronic
1017609474 6:156169804-156169826 AAAACCAAGGTGCCATATTATGG - Intergenic
1018519412 6:164630069-164630091 GAAAACACTGTGCCACAAGAGGG - Intergenic
1022074371 7:26953062-26953084 AAGATCAAGGTGCCTCATGAGGG - Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1030170307 7:106595007-106595029 GTCACCCAGGTGACACATGATGG - Intergenic
1034997438 7:155587086-155587108 GCAGCCAGGGTGGCACATGATGG + Intergenic
1035071171 7:156146126-156146148 GAAACCAAGATGGCCCCTGAAGG + Intergenic
1035181421 7:157092079-157092101 GAAACCAAGGCGTCACAGGGCGG - Intergenic
1036748176 8:11424794-11424816 GAAAGCAAGGTGACAAATGAGGG + Intronic
1037780261 8:21863372-21863394 GAAATGGAGTTGCCACATGAAGG - Intergenic
1038245639 8:25852414-25852436 GAAACCAAGGCGCCATTTGGGGG - Intronic
1038355646 8:26826664-26826686 CAAAGCAAGGTGGCACATGCTGG - Intronic
1038911684 8:31971969-31971991 GAAACCCAGGTTCCAAATGCAGG - Intronic
1039243377 8:35581326-35581348 GGAGACAAGGTGCCACATTAAGG - Intronic
1042598413 8:70473653-70473675 GTCACCAAGGTGCTACATAAAGG - Intergenic
1045564830 8:103303142-103303164 GCAGCCAGGGTCCCACATGAAGG - Intronic
1046152387 8:110244651-110244673 GAAAGCAAGGTGCCAGAAGTGGG - Intergenic
1047088874 8:121551492-121551514 GAAATCTAGGTGCCACAGTAAGG - Intergenic
1048457573 8:134591929-134591951 GCAATCAAAGTGCCACATGCTGG - Intronic
1049198227 8:141326973-141326995 GAGACAGATGTGCCACATGAAGG + Intergenic
1050412227 9:5378335-5378357 GAAAACATGCTGGCACATGAGGG - Intronic
1053826743 9:42032793-42032815 AAGACCAGGGTGCCAGATGAGGG + Intronic
1054603815 9:67154630-67154652 AAGACCAGGGTGCCAGATGAGGG - Intergenic
1057146292 9:92761450-92761472 GACACCAAGGTGGCACACCAAGG + Intronic
1057818820 9:98315716-98315738 GGCACCAAAGAGCCACATGAAGG + Intronic
1058219322 9:102277419-102277441 GAAAACATGGTGCCACACGATGG - Intergenic
1058286153 9:103181552-103181574 CAAAACAAGCAGCCACATGAAGG - Intergenic
1058781781 9:108344309-108344331 GAAACCAAGGCCCCACATGGAGG - Intergenic
1060706386 9:125805503-125805525 GAAAACAATGTGCCACTTGGAGG + Intronic
1060792398 9:126495313-126495335 GACACCCAGGTGCCACAGGGAGG + Intronic
1060983497 9:127807079-127807101 GAGACCAAGGTGCCGCATGCAGG + Exonic
1062430532 9:136525139-136525161 GAAACCAAGGTGCCAGGAGGAGG + Intronic
1185736389 X:2500185-2500207 GAAACAAAGTTGCCACTTAACGG + Intronic
1187299185 X:18031420-18031442 GAAACCAAGGTTTCCCATCAAGG - Intergenic
1190053435 X:47168902-47168924 ACAACCAAGGTGCCCCATGAGGG + Intronic
1190438713 X:50454393-50454415 GAAATCAAGGTGAGAGATGATGG - Intronic
1194379793 X:93177999-93178021 GACACAAAGGTGCCTCAGGAGGG - Intergenic
1194733453 X:97483370-97483392 GAAACTAAAGTGCCAGTTGAAGG + Intronic
1201421469 Y:13804448-13804470 GAAACAGAGCTCCCACATGAAGG - Intergenic
1202073137 Y:21013457-21013479 GACAAAAGGGTGCCACATGAGGG - Intergenic
1202077837 Y:21055311-21055333 GACAAAAGGGTGCCACATGAGGG - Intergenic