ID: 909351339

View in Genome Browser
Species Human (GRCh38)
Location 1:74656574-74656596
Sequence GCATTTTACTTGATGGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909351339_909351345 20 Left 909351339 1:74656574-74656596 CCATTATCCATCAAGTAAAATGC 0: 1
1: 0
2: 1
3: 20
4: 170
Right 909351345 1:74656617-74656639 AACATCTCAGTTTACTGGTCTGG No data
909351339_909351344 15 Left 909351339 1:74656574-74656596 CCATTATCCATCAAGTAAAATGC 0: 1
1: 0
2: 1
3: 20
4: 170
Right 909351344 1:74656612-74656634 AAGTGAACATCTCAGTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909351339 Original CRISPR GCATTTTACTTGATGGATAA TGG (reversed) Intronic
902499712 1:16901814-16901836 GCATGTGAATTGATTGATAAAGG - Intronic
905838235 1:41149555-41149577 GAATTTTACCTGATGGGTACTGG + Intronic
907099308 1:51813602-51813624 GCATTTTCCTTGATTGAAATAGG - Intronic
908935153 1:69366546-69366568 GCATATCACTTTATGGGTAATGG + Intergenic
909351339 1:74656574-74656596 GCATTTTACTTGATGGATAATGG - Intronic
909588146 1:77313973-77313995 GCTATTTGCTTGATGGACAAAGG + Intronic
910380323 1:86620302-86620324 GAATTTTACTTTAAGTATAATGG - Intergenic
910498060 1:87855504-87855526 ACAGTTTACGTGATGGATATTGG - Intergenic
911032415 1:93503681-93503703 CCATTTTGATTGATGGAAAATGG + Intronic
913363374 1:118007408-118007430 GCTTTTCACTTGCTGGAGAAAGG - Intronic
913401140 1:118434511-118434533 CCATTCTAATTGATGGATAGTGG + Intergenic
914420865 1:147527252-147527274 TCATATTACCTGATGGATATAGG + Intergenic
917026123 1:170644278-170644300 ACTTTTTATTTGATGAATAATGG + Intergenic
918073538 1:181151759-181151781 GCATTTTACTTCCTCGATTAGGG + Intergenic
918849699 1:189670925-189670947 ACATTCTACTTGATGCTTAAGGG + Intergenic
919525911 1:198650221-198650243 GAATTTTACCTGAAGTATAAAGG + Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
1065399157 10:25276729-25276751 GCATTTTTCTTGATTAAAAATGG - Intronic
1068411873 10:56666387-56666409 GCATCTGACATGATGAATAAAGG + Intergenic
1068700669 10:60016285-60016307 GTATTTTACATGATGAGTAAGGG - Intergenic
1073664404 10:105514021-105514043 GCATTTCTTTTGATGGCTAAAGG + Intergenic
1074675759 10:115848864-115848886 GCATTTTATTTTATGCTTAAGGG - Intronic
1076197048 10:128526351-128526373 GCATTCTGCTTGATGGACAAAGG - Intergenic
1077290177 11:1785662-1785684 TCATTTTATTTGAAGTATAATGG + Intergenic
1078453727 11:11458981-11459003 GCGTTTTACTTGAGCGAGAAGGG + Intronic
1079008391 11:16809108-16809130 GCATTTTACTTGATGGTGCCAGG - Intronic
1079643609 11:22835760-22835782 ACATTTTACTTTAAGGAAAAAGG + Intergenic
1081509325 11:43753248-43753270 GCATTATACTTTATGGACCATGG - Intronic
1085543281 11:77292920-77292942 TCAATTTACTTGATAGATAAAGG - Intronic
1085831749 11:79908756-79908778 GCATTTTACCTGATAGGGAAAGG - Intergenic
1087004543 11:93456693-93456715 ACATTTTACTTAATGGTAAAAGG + Intergenic
1087273543 11:96137945-96137967 ACATTGTTCTTGATGGATACAGG - Intronic
1087321571 11:96666595-96666617 GCATTTTACTAGATGATTGAGGG + Intergenic
1089385784 11:118066877-118066899 TCATTTTACTTGATAGAAACTGG - Intergenic
1090821066 11:130342261-130342283 ACATTTTACTGGAGGGAAAATGG + Intergenic
1091512347 12:1141073-1141095 GCATTAAACTTCAGGGATAAAGG + Intronic
1091665941 12:2418647-2418669 TCATTTTACTTGCTGGAGGAGGG - Intronic
1092051103 12:5470776-5470798 GCATTTGACTTCATAGATAAGGG - Intronic
1093869361 12:24269144-24269166 GCATTTTACTTTATAGATTAGGG + Intergenic
1095286692 12:40420414-40420436 CCATTTTAGTTAATGGAGAAAGG + Exonic
1095434216 12:42169742-42169764 GCATTATTCTTGAAGGATATGGG + Intronic
1096751578 12:53762321-53762343 GCATATTTATTGATTGATAAAGG + Intergenic
1096810679 12:54167727-54167749 GCATATTCCTTGAACGATAAAGG - Intronic
1099509857 12:83520845-83520867 GCATTTAGCATGATTGATAATGG - Intergenic
1099591551 12:84597796-84597818 GCATTTTTCCTGATAGAGAAGGG + Intergenic
1099787277 12:87282484-87282506 GCATTATACTTCATGGATAATGG + Intergenic
1099807790 12:87542399-87542421 ACCTTTAACTTCATGGATAAAGG + Intergenic
1100155695 12:91797874-91797896 GCATTTTACTGCATCAATAACGG - Intergenic
1101619757 12:106373964-106373986 CCATTTTTCTTTTTGGATAATGG + Intronic
1103314106 12:120038191-120038213 GCATGTGTCTTGATGGAAAACGG - Intronic
1103502761 12:121416502-121416524 GTATTTTTCTAGATGGAAAATGG - Intronic
1105325741 13:19369423-19369445 GCATTTTATTTTAGGGAAAATGG - Intergenic
1105867760 13:24475686-24475708 GCATTTTATTTTAGGGAAAATGG + Intronic
1107284248 13:38772593-38772615 GCATTTTACTTGATGTTTACAGG + Intronic
1107882743 13:44847042-44847064 ACATTCTATATGATGGATAAAGG + Intergenic
1111265037 13:85799161-85799183 GAATTTTAATTGAGGGAAAAAGG - Exonic
1111802376 13:92996597-92996619 GGATTTTACTTTAGGTATAAAGG - Intergenic
1116982757 14:51188887-51188909 GAATTTTGCTTGATGGAAGATGG - Intergenic
1118611563 14:67544882-67544904 GAATCTTACTTGATAGATACAGG - Intronic
1120321162 14:82962730-82962752 GAATTTTATTGGAAGGATAAGGG - Intergenic
1121839735 14:97123140-97123162 TCATGTAACTTGATGGAGAAAGG + Intergenic
1124608356 15:31189766-31189788 TCATTCTCCTTGATGGATATAGG - Intergenic
1126739551 15:51763917-51763939 CCAATTCATTTGATGGATAAGGG + Intronic
1128738584 15:70067694-70067716 GCATTTCAGGTTATGGATAAAGG + Intronic
1129955917 15:79636750-79636772 GCATTTTCTTTGATTGCTAAAGG - Intergenic
1133672949 16:8041981-8042003 GCATTTTACATGATTATTAAAGG - Intergenic
1138566689 16:57838671-57838693 GCATTTTGCTTTTTGGAAAATGG - Intronic
1139017751 16:62710967-62710989 ACATAATATTTGATGGATAAGGG - Intergenic
1139204409 16:65013293-65013315 GGACTTTACTGGATGGACAATGG + Intronic
1142832063 17:2556523-2556545 GCATGGTACTTGGTGTATAATGG - Intergenic
1149006392 17:51810619-51810641 CCATTTTATTTGAAGGACAAAGG + Intronic
1150892229 17:69165988-69166010 ACATTTTTCTTGATTGCTAATGG - Intronic
1150968711 17:70002190-70002212 GCATTATAATAGATGGATAGTGG - Intergenic
1155717072 18:28956971-28956993 TCATTTTAATGGATCGATAATGG - Intergenic
1158868900 18:61665236-61665258 CCATTTTACAGGATGGAAAATGG + Intergenic
1159721934 18:71901077-71901099 GCATTTTCCTCAATCGATAAAGG - Intergenic
1160273144 18:77406021-77406043 GCATTTTACAAGATGGCTAAAGG - Intergenic
1160304548 18:77719581-77719603 GCATTTTACTGGCTGGATCACGG - Intergenic
925722471 2:6842486-6842508 GAACTTGACTTGATGGCTAAAGG - Intronic
925932154 2:8717007-8717029 GCAATTAAATGGATGGATAAAGG - Intergenic
928942063 2:36736200-36736222 GCATTTTTCTTGATTGTTTAAGG + Intronic
933243221 2:79946117-79946139 GCATTAGACTTGATGGATGCAGG - Intronic
935501742 2:103849449-103849471 GCATTTTAATAGGTGGATAGAGG - Intergenic
937779805 2:125823963-125823985 GTATTTTGCATGATTGATAAGGG - Intergenic
938660861 2:133485757-133485779 GCATTTTATTTGCTGCATACTGG + Intronic
938750619 2:134325971-134325993 GCAAGTTATTTCATGGATAATGG + Intronic
938936579 2:136132671-136132693 GCAAGTTACTTGATGGATTAGGG + Intergenic
941312909 2:163956412-163956434 CTATTTTACTTGGTGTATAAGGG - Intergenic
942007793 2:171724337-171724359 GCATTTTGTTTGCTGGGTAAAGG + Intronic
943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG + Intergenic
944178148 2:196856769-196856791 CTTTTTTACTTGAAGGATAATGG + Intronic
944346510 2:198672467-198672489 ACATTTTACTTGAATAATAAAGG - Intergenic
1169968169 20:11240073-11240095 GGATTTTACATGCTGGAGAAAGG - Intergenic
1170868017 20:20177564-20177586 GGATTTTACTGGATGAATGAGGG - Intronic
1174850713 20:53991481-53991503 GCTTTTGACTTGGTGGAAAATGG + Intronic
1175352993 20:58339437-58339459 TCATTTAACTTGATCGTTAAAGG + Intronic
1177663956 21:24127060-24127082 ACATTTTTCTTGATAGACAAAGG + Intergenic
1177795785 21:25777829-25777851 TCATTTGACTTAATGGTTAAAGG + Intergenic
1177937094 21:27362468-27362490 GCATTGAACTTGATGGAGTAAGG - Intergenic
1178131312 21:29575402-29575424 GCATTTTGTTAGATGGATATAGG - Intronic
1178353663 21:31892734-31892756 GCATTTTATTTTAAGGATAAAGG + Intronic
1182139789 22:27943784-27943806 CCATTTTGCTTGATGGGTAATGG + Intergenic
949759338 3:7451973-7451995 GCATTGCACGTGATGGAAAATGG + Intronic
954798400 3:53173077-53173099 ACATGTAACTTGTTGGATAATGG - Intronic
956603073 3:71043916-71043938 CCATTTTTCTCTATGGATAATGG - Intronic
956974202 3:74561344-74561366 GAATTTTATTTCATGGACAATGG - Intergenic
957509742 3:81171887-81171909 GCATTTAACTTGATAGATCAGGG - Intergenic
957522316 3:81334713-81334735 ACATTTTACTTGAAGTACAATGG + Intergenic
958628901 3:96663731-96663753 GCCTTTTACTTGATGTAAGAAGG - Intergenic
958741096 3:98073349-98073371 GCATTTTCCTTGATGAAGAAAGG - Intergenic
959775587 3:110158082-110158104 ACATTTTACTTGATGGTTTGTGG - Intergenic
962465396 3:135652724-135652746 GCATCTTACATGGTGGATCAGGG + Intergenic
963621600 3:147614339-147614361 CCATATTAATTGCTGGATAAAGG + Intergenic
966966260 3:184997645-184997667 GCATTTCACTTGTTGGCTTATGG - Intronic
967614036 3:191543438-191543460 TCATTTTTCTTGATTGAGAAGGG - Intergenic
968200679 3:196752146-196752168 GCATTTTGCATTTTGGATAAGGG + Intronic
970914654 4:21318960-21318982 GAATTTTACTAAATTGATAATGG + Intronic
971269187 4:25123023-25123045 GCATTTTTCCTTTTGGATAAGGG - Exonic
972664916 4:41156129-41156151 AAATGTTACTTGGTGGATAATGG - Intronic
974972132 4:68843565-68843587 GCATTATACTTAATGTAGAAAGG - Intergenic
975322713 4:73026423-73026445 GCATTTGCCTTGATGCACAATGG + Intergenic
976337496 4:83907411-83907433 GCATTTTACTTATTGGTAAATGG + Intergenic
980070557 4:128238893-128238915 GTATTTTACTTAATGGTGAAAGG + Intergenic
980705433 4:136486992-136487014 GCATTTTAATTGAGAGATAATGG + Intergenic
980997616 4:139795424-139795446 GCATTTTAGTTGAGTGTTAAGGG + Intronic
982368803 4:154610536-154610558 GCTTTTTACTTTATGCATAAGGG + Intronic
983330799 4:166325853-166325875 GCATTTTAATTGGTGTATACAGG - Intergenic
984379547 4:178973317-178973339 CCATTTTACTAAATAGATAATGG + Intergenic
984420736 4:179517380-179517402 ACGTGTTACTTGATCGATAAGGG + Intergenic
984742205 4:183176037-183176059 GCATTTTTGTTTATGAATAAGGG + Intronic
987689406 5:21247275-21247297 CCATTTCCCTTTATGGATAATGG - Intergenic
990275840 5:54195322-54195344 GCATGTTTCTTAATGAATAAAGG - Intronic
990735818 5:58860761-58860783 GCATATTACTTGAGGGAATAGGG - Intergenic
992711679 5:79464471-79464493 CCATTTAACTTGATAGGTAATGG + Intronic
995618722 5:113998685-113998707 GGGCTTTAATTGATGGATAATGG + Intergenic
999277686 5:150342518-150342540 ACATTTTAGTTGTTGGATCATGG - Intergenic
1000276343 5:159738803-159738825 GCATTTCAAGTGATGGAGAAAGG + Intergenic
1001172195 5:169430248-169430270 GAATTTTCTTTGGTGGATAAAGG - Intergenic
1001301493 5:170536897-170536919 GCATTAGACTTGCTGGATTAAGG + Intronic
1001777651 5:174340821-174340843 GCATCTTCCTTGATGCATTAAGG + Intergenic
1003169819 6:3712563-3712585 ACATTGTGCTTGATGGATGACGG + Intergenic
1004380902 6:15131746-15131768 GCATTTTTCTTAATGTATTAGGG - Intergenic
1004581199 6:16954770-16954792 GTATTTAACTTAATAGATAATGG + Intergenic
1005622339 6:27631563-27631585 GCTTTTTACTTTAAAGATAAGGG - Intergenic
1006482011 6:34303035-34303057 GCATTTATATGGATGGATAAAGG - Intronic
1007605308 6:43113780-43113802 GCATTTATCTTGATGAATAATGG + Intronic
1008316898 6:50054784-50054806 TCAGTTTACTAGAGGGATAAGGG - Intergenic
1010850363 6:80768245-80768267 GAATTTGACTTGATAAATAATGG + Intergenic
1011390985 6:86853123-86853145 GCATTATACTTAATTAATAATGG - Intergenic
1011949327 6:92944679-92944701 GCATTATACTTTCTGGAGAATGG - Intergenic
1012099889 6:95019438-95019460 GGCTTTTACTCGATGGCTAATGG + Intergenic
1012583747 6:100898408-100898430 GCTTTCTATTTCATGGATAAAGG + Intergenic
1013269100 6:108529198-108529220 TCATGTTACATGATGGAGAAAGG + Intergenic
1013936167 6:115597152-115597174 TAATTTTAATAGATGGATAATGG + Intergenic
1014459043 6:121673414-121673436 CCATTTAACTTGATGTTTAAAGG - Intergenic
1015229839 6:130901975-130901997 GCATTTTATTTCATGGAAAACGG - Intronic
1015911416 6:138171171-138171193 GCATTTTACTTGCTGACTAAAGG + Intronic
1018428662 6:163705866-163705888 TCATTTTACATGATACATAATGG - Intergenic
1021539129 7:21737457-21737479 GTATTTCATTTGATGGAAAATGG + Intronic
1024895612 7:54258520-54258542 GCATTTTAGTTGAAGGAAAATGG + Intergenic
1026347853 7:69490457-69490479 GCATTTAACTTGATGGATGGAGG - Intergenic
1027551563 7:79603706-79603728 ACATTATACTTGATGGAAAATGG - Intergenic
1027556899 7:79675845-79675867 GCATTATATTTGATGAATTAAGG - Intergenic
1029226190 7:99030342-99030364 GCATTTTATTGGATGGGTGATGG + Exonic
1030073489 7:105717614-105717636 GCATTTGACTAGATGTATCAAGG - Intronic
1030343147 7:108403589-108403611 GCAATTCATTTGCTGGATAAAGG + Intronic
1031381074 7:121086765-121086787 GCAAATCATTTGATGGATAAGGG + Intronic
1031463773 7:122083333-122083355 GTATTTTAGATGTTGGATAAAGG - Intronic
1033643166 7:143281948-143281970 TCATTTTCCTTGATTGACAAAGG + Intronic
1036074714 8:5483287-5483309 GCATTTTACTGGATGGTGAGAGG - Intergenic
1038903753 8:31873968-31873990 ACATTTTCATTGATGGATCAAGG - Intronic
1043178453 8:77051955-77051977 GCATTCTACTTGAGGGTGAATGG + Intergenic
1043574114 8:81637506-81637528 TCATTTTAATTGATGCTTAAAGG + Intergenic
1047144987 8:122188394-122188416 ACACTTTTCTTAATGGATAAAGG + Intergenic
1047429929 8:124782369-124782391 GCATTTTGCTTAATACATAAAGG - Intergenic
1047903175 8:129445620-129445642 TCATTTTGCTTCATGAATAATGG - Intergenic
1050705319 9:8390233-8390255 GGATTTTATTTGAAGTATAAGGG - Intronic
1051137704 9:13941582-13941604 TCATTTTAATTGATTGATACTGG - Intergenic
1055150916 9:72998416-72998438 ACATTTTACTTGATGACTGAAGG + Intronic
1056848472 9:90060234-90060256 GCATTTTAGTTGGTAGATATTGG + Intergenic
1056874214 9:90312372-90312394 GAAGGTTAATTGATGGATAAGGG + Intergenic
1058938966 9:109795606-109795628 GCATTTTAGGTGTTGGAGAAAGG + Intronic
1186191598 X:7072193-7072215 GCATATTTCTTAATGAATAAGGG - Intronic
1188041360 X:25373041-25373063 GCATTTTACTGTATGCTTAAAGG + Intergenic
1189340209 X:40199210-40199232 GCCTTTTTCATGAGGGATAAGGG - Intergenic
1191788501 X:64943568-64943590 GGATATTACATGATGGAAAAGGG - Intronic
1193348147 X:80428406-80428428 GAATTTAACTTAATGGCTAAAGG - Intronic
1193918286 X:87394789-87394811 CCTGTTTACTTGACGGATAATGG + Intergenic
1194578939 X:95647306-95647328 GCAATTTAATAAATGGATAAAGG - Intergenic
1197673472 X:129304083-129304105 GTATTTAATTTGGTGGATAAGGG - Intergenic
1198001361 X:132441478-132441500 GCATGTAACTTGATGCAGAAGGG - Intronic
1199146561 X:144375913-144375935 GCATTGAACTTGTTAGATAAGGG - Intergenic