ID: 909352090

View in Genome Browser
Species Human (GRCh38)
Location 1:74665835-74665857
Sequence ACATATAAATTACAGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909352081_909352090 26 Left 909352081 1:74665786-74665808 CCTGTCTCCAATACAGTCACATT 0: 1
1: 11
2: 24
3: 66
4: 326
Right 909352090 1:74665835-74665857 ACATATAAATTACAGTGGGAGGG 0: 1
1: 0
2: 4
3: 22
4: 277
909352083_909352090 19 Left 909352083 1:74665793-74665815 CCAATACAGTCACATTCTGAGGA 0: 2
1: 9
2: 37
3: 58
4: 361
Right 909352090 1:74665835-74665857 ACATATAAATTACAGTGGGAGGG 0: 1
1: 0
2: 4
3: 22
4: 277
909352080_909352090 27 Left 909352080 1:74665785-74665807 CCCTGTCTCCAATACAGTCACAT 0: 2
1: 11
2: 35
3: 89
4: 408
Right 909352090 1:74665835-74665857 ACATATAAATTACAGTGGGAGGG 0: 1
1: 0
2: 4
3: 22
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909352090 Original CRISPR ACATATAAATTACAGTGGGA GGG Intronic
902632110 1:17711081-17711103 ACATTTAACTTACCCTGGGAGGG - Intergenic
905984635 1:42268153-42268175 CCATATTAATTACAGTGAAAGGG + Intronic
906140200 1:43529871-43529893 ACATTTAAATTACATTTAGAGGG + Intronic
906141608 1:43537003-43537025 ACAAAGAAACCACAGTGGGAGGG - Intronic
908632823 1:66129270-66129292 ACAGTGAAATTACAGTGGGTGGG + Intronic
909352090 1:74665835-74665857 ACATATAAATTACAGTGGGAGGG + Intronic
909508643 1:76425080-76425102 TCATGTAAATTATAGTGAGAGGG + Intronic
909622767 1:77685677-77685699 ATACATAAAGTACTGTGGGAGGG + Intergenic
915609055 1:156976387-156976409 AAATTCAAATTACAGTAGGAGGG - Intronic
916900037 1:169212400-169212422 ACAAATAAATTTCAGTGAGTAGG - Intronic
918802675 1:188992270-188992292 TCATATAAATTAGCTTGGGAGGG + Intergenic
919262902 1:195220795-195220817 ATATATAAATTAGACTGGCATGG + Intergenic
919660346 1:200237848-200237870 ACATTCACATTACAGTGTGAAGG - Intergenic
920579597 1:207093677-207093699 ATATATTTATTACATTGGGATGG + Intronic
924278387 1:242411151-242411173 ATATATCAATTAGAGTTGGAAGG - Intronic
1063866467 10:10370361-10370383 ACAAATAAATTTCAGTGAGTAGG + Intergenic
1065569794 10:27058870-27058892 ACATAAAAATCACTGTGGGCTGG - Intronic
1065911780 10:30312984-30313006 ACATATAAATTAAAGTGGGTTGG - Exonic
1066170914 10:32844241-32844263 ACATAAAAACTCCAGTGGAAAGG + Intronic
1068024595 10:51627612-51627634 ATATAGCAATTACAGTTGGAAGG + Intronic
1068332685 10:55591969-55591991 ACATGTAAATTAAAGTGATAAGG + Intronic
1068442469 10:57076143-57076165 ATTTATATAATACAGTGGGAAGG + Intergenic
1069785662 10:70986360-70986382 ACACAATAATTACATTGGGATGG + Intergenic
1069890082 10:71647066-71647088 AGATACAAATGACACTGGGAGGG - Intronic
1071500008 10:86196615-86196637 ACATATGAATCACAGTGAGATGG - Intronic
1072141054 10:92589546-92589568 ACATATAAAGTACACTGGCTGGG - Intergenic
1073719951 10:106157254-106157276 ACAAATGAAACACAGTGGGAAGG - Intergenic
1077208588 11:1356245-1356267 ACACAGATATTACAGAGGGAAGG + Intergenic
1078119875 11:8496206-8496228 ATATGCAAATTACAGAGGGAAGG + Intronic
1078344925 11:10539690-10539712 ACATATATATTAGAGAGAGAAGG + Intronic
1078920434 11:15825753-15825775 GGATATAAATAAGAGTGGGAAGG - Intergenic
1079850300 11:25524917-25524939 ACATATTAATTTGGGTGGGAGGG + Intergenic
1079935596 11:26612392-26612414 AAATATAAATTGTAGGGGGAGGG - Intronic
1080160916 11:29175056-29175078 TAATATTAATTACAGTGAGATGG + Intergenic
1080169109 11:29277436-29277458 ACATATGAATTACAGGGGCAAGG - Intergenic
1080238139 11:30095816-30095838 ATCTATAAATTACATTGGGCAGG + Intergenic
1080272970 11:30470320-30470342 ATATATAAATTATAGTTAGATGG + Intronic
1080479190 11:32628098-32628120 ACTAGTAATTTACAGTGGGAAGG - Intronic
1081750954 11:45511017-45511039 ACATGGAAAGTAAAGTGGGAAGG + Intergenic
1083043125 11:59707440-59707462 ACATATAAATTTGGGTTGGAGGG - Intergenic
1083541941 11:63517624-63517646 ACATATAAATTTTAGTTGGGAGG - Intergenic
1085316232 11:75546772-75546794 AAAAATAAATAAAAGTGGGAAGG + Intergenic
1085462762 11:76704457-76704479 ATATGTAAATTACAGGGGGATGG + Intergenic
1085610861 11:77947748-77947770 AAATATAAATTGAAGTGGGGAGG + Intronic
1087411606 11:97797504-97797526 AACTATAAATAACAGTAGGATGG - Intergenic
1087750660 11:102003378-102003400 AAATATAAATAAAAGTGGGCTGG + Intergenic
1088385024 11:109244641-109244663 ACCTATAAATTACTTTGGGCAGG - Intergenic
1089331744 11:117694027-117694049 ACCTAAAAATGACAGAGGGAGGG - Intronic
1090240494 11:125178127-125178149 ATATATAAAATACAGTGGTTGGG - Intronic
1091964933 12:4732053-4732075 GAATATATATTACATTGGGAGGG - Intronic
1092324366 12:7513873-7513895 ACATATAAATTGCAGGTGTATGG + Intergenic
1093903640 12:24663895-24663917 ACATATATTTTAGAGTTGGAAGG - Intergenic
1095484371 12:42669661-42669683 CCATATAAATAGCAGTGTGATGG + Intergenic
1095530850 12:43184402-43184424 ACACATGAATTTCAGGGGGATGG + Intergenic
1096003003 12:48144996-48145018 ACATAAAAATTACAGAGGGAAGG - Intronic
1097406871 12:59199890-59199912 ACAATTAAATTCCACTGGGATGG + Intergenic
1101533034 12:105591911-105591933 ATATTTAAATGACAGTGGGAAGG - Intergenic
1101581491 12:106045993-106046015 CATTATAAAGTACAGTGGGATGG - Intergenic
1102382499 12:112479415-112479437 ATATGAAAATTACAGTAGGAAGG - Intronic
1102848153 12:116210071-116210093 ATATGTAAGTTGCAGTGGGAAGG - Intronic
1106950331 13:34876253-34876275 ACTTCTAAATTAAAGTGGGGAGG + Intergenic
1106999375 13:35525943-35525965 GCATATGAATTTCAGAGGGAAGG + Intronic
1107954909 13:45502334-45502356 ACCACTAAATTACACTGGGAAGG - Intronic
1108107756 13:47030827-47030849 ACATACAAATGACAGTTTGAGGG + Intergenic
1108799368 13:54074989-54075011 ACATATTAATGTCAGTGAGATGG + Intergenic
1109603799 13:64665070-64665092 ACATTAAAAATAGAGTGGGATGG - Intergenic
1110241059 13:73267417-73267439 AAATATAGATTACAGAGGGTTGG - Intergenic
1111624733 13:90770315-90770337 ACATAGGCATTCCAGTGGGAAGG - Intergenic
1111869818 13:93817385-93817407 TCATATAAATAATAATGGGATGG + Intronic
1112474789 13:99721625-99721647 AAATAAAAATTAGAGGGGGAGGG - Intronic
1112496220 13:99907025-99907047 TCATGTAAATTACAGAGGTATGG + Intergenic
1113323547 13:109262213-109262235 ACATATAATATACAATGGAAAGG + Intergenic
1114005564 14:18309579-18309601 CCATATTGATTATAGTGGGAAGG - Intergenic
1114976566 14:28107890-28107912 ACATAGAAATTACATTGGGGTGG - Intergenic
1117331274 14:54714540-54714562 ACAAGTAAATTACAGTGCTAGGG + Intronic
1117792974 14:59360691-59360713 ACATTTAAATTAAAATAGGATGG + Intronic
1119203828 14:72779163-72779185 GCATTTAAATTACAGCAGGAAGG + Intronic
1119377638 14:74207355-74207377 ATATAACAATTACAGTGGGGTGG + Intergenic
1119606722 14:76025090-76025112 AAATATATATACCAGTGGGATGG + Intronic
1119760368 14:77146518-77146540 ACATCTCAATTACAGGAGGAGGG + Intronic
1120132734 14:80825403-80825425 ACATATAAATTAAATAGGGCTGG - Intronic
1121672270 14:95721296-95721318 ACATATAAAATGTAGTTGGAGGG - Intergenic
1123680726 15:22761545-22761567 AAATATAAAATACAGTGGCCGGG + Intergenic
1124332935 15:28836003-28836025 AAATATAAAATACAGTGGCCGGG + Intergenic
1125973660 15:43932783-43932805 ACAGATAAATGAGAGAGGGATGG + Intronic
1126406435 15:48327748-48327770 ACATCTAAATTAGAGGGGAAAGG + Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1127067377 15:55254735-55254757 TCACATATATTACAGTGGAAGGG + Intronic
1127750955 15:62042765-62042787 AAATATAAATTACAGGGGGAAGG + Intronic
1130793109 15:87177763-87177785 AAATATAAATTACCCTGGGAAGG + Intergenic
1131489310 15:92848880-92848902 ACATACGAATTTCAGGGGGAGGG - Intergenic
1133483314 16:6193420-6193442 ATATATAAAATTCAGTGAGAAGG + Intronic
1135034477 16:19065454-19065476 AGATAGAAAGTACAGAGGGAGGG + Intergenic
1135282370 16:21163695-21163717 ACAAATAAATTTCAGTGAGGAGG + Intronic
1137466340 16:48713272-48713294 ACATATGAATTTGAGGGGGATGG - Intergenic
1137868569 16:51927442-51927464 ACATATAATTTGCGGTGGGGTGG - Intergenic
1137894815 16:52199848-52199870 ACAGATATATTAAAATGGGAGGG - Intergenic
1138835245 16:60426914-60426936 ACATATTAAATACAGTAGCAAGG - Intergenic
1138960362 16:62022147-62022169 AAATATAAATGAGAATGGGAAGG + Intronic
1138979940 16:62255864-62255886 AAAAAAAAATTACAGTGGCAAGG + Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1145074789 17:19843482-19843504 ACACATAAAGTACAGTAAGAGGG + Intronic
1145097874 17:20047088-20047110 ACATTTAACTTTCAGTGGGCTGG + Intronic
1145728578 17:27155705-27155727 ACCTAGAAATCACAGTGGGGAGG + Intergenic
1147011265 17:37450478-37450500 AGAAATACATTGCAGTGGGAAGG + Intronic
1150842403 17:68621075-68621097 ACCTATAAATTTCCGTGAGAAGG + Intergenic
1154400044 18:14027959-14027981 ACATATAAATATCTGTGGGTTGG + Intergenic
1154531866 18:15354295-15354317 CCATATTGATTATAGTGGGAAGG + Intergenic
1155086570 18:22464545-22464567 ACAGATAGATTAGAGTGGGGAGG - Intergenic
1155277507 18:24202928-24202950 ACAACTAAATTAGAGGGGGATGG + Intronic
1155414965 18:25588058-25588080 AAATAAAAAATACAGTGGCAAGG - Intergenic
1157003343 18:43552730-43552752 ACATATAATTGACAGTGAGGGGG + Intergenic
1157994449 18:52538343-52538365 AAAAATAAATTGCAGTGGGTTGG - Intronic
1158274646 18:55754310-55754332 ACATATAAATTTGGGTGGGGAGG - Intergenic
1158346266 18:56519933-56519955 ACATAGAAATTAGAGAGGGAAGG + Intergenic
1159678357 18:71314848-71314870 ACCTATAAAATACAGTGTGTAGG + Intergenic
1159957957 18:74533130-74533152 ACATATAAATTTTGGTGGGAAGG - Intergenic
1166407465 19:42531206-42531228 ACATATAAGGTACAGTGATAAGG - Intronic
1168336013 19:55598192-55598214 AGGCTTAAATTACAGTGGGAGGG - Intronic
1168597658 19:57691801-57691823 ACATATAAATTACTGATAGAAGG + Intronic
927818308 2:26240458-26240480 AAGTAGAAATTCCAGTGGGAAGG + Intronic
928541458 2:32288340-32288362 ATATATAAATTATAGTGCTAAGG - Intronic
930794303 2:55371636-55371658 ATATAATAATTACAGTGGAATGG - Intronic
934071619 2:88389601-88389623 ACATATAAAAAACAGTGGCCGGG + Intergenic
935131975 2:100267449-100267471 ACATATGAATTTCTGTGGCAGGG + Intergenic
937061723 2:118984952-118984974 ACAGAAAAATTACAGTGCGTTGG + Intronic
937946604 2:127344254-127344276 AAAGATATATTACAGTGGAAGGG - Intronic
938530965 2:132185531-132185553 CCATATTGATTATAGTGGGAAGG + Intronic
939952316 2:148489905-148489927 ACATCCAAAAAACAGTGGGACGG + Exonic
940307565 2:152243028-152243050 AAACATAAAATACAATGGGATGG - Intergenic
941796980 2:169609952-169609974 ACAAATAAATTTTAGTGAGAAGG - Intronic
942368133 2:175251174-175251196 ATATATATATTACATTGAGATGG + Intergenic
944380656 2:199106144-199106166 ACATATTAATTACTCTTGGAAGG - Intergenic
944719895 2:202412988-202413010 ACAAATAAATTTCAGTGAGTAGG - Intronic
945050019 2:205814917-205814939 GCATATAAATTATAGTGGGGTGG - Intergenic
945784739 2:214218849-214218871 ACTGGTAAATTACACTGGGATGG - Intronic
946469766 2:219947593-219947615 ACATATATATGATATTGGGAAGG + Intergenic
947880361 2:233504008-233504030 AAATATAAATTGTAGAGGGAAGG + Intronic
947941809 2:234063222-234063244 ACAAATAAATTATTGTTGGAAGG + Intronic
1171950308 20:31415651-31415673 ATATATATATTACAGTAGAACGG + Intergenic
1173573436 20:44093608-44093630 ACATATGAATTAAGGTGGGAGGG + Intergenic
1174622230 20:51884482-51884504 ACAAATAAATTTCAGTGAGTAGG + Intergenic
1175645968 20:60671935-60671957 ACATAGTAAGTACATTGGGAAGG + Intergenic
1176765495 21:13013878-13013900 CCATATTGATTATAGTGGGAAGG - Intergenic
1177391182 21:20475020-20475042 ACAAATAAATTTTAGTGAGAAGG - Intergenic
1177809780 21:25913952-25913974 ATATACAAATTTGAGTGGGAGGG - Intronic
1177877519 21:26651885-26651907 ACATATGAATTTCAGAGTGAAGG - Intergenic
1178290058 21:31359492-31359514 ACATAGAAAATACAGTGAAAGGG + Intronic
1179231590 21:39508380-39508402 AAATAGAAATTCCAGTGGGCTGG + Intronic
1180430073 22:15240365-15240387 CCATATTGATTATAGTGGGAAGG - Intergenic
1180512684 22:16108687-16108709 CCATATTGATTAGAGTGGGAAGG - Intergenic
1182938525 22:34250892-34250914 ATATATAAAGTACAATGTGATGG - Intergenic
1184553350 22:45217749-45217771 ACAAATAAATTTCAGTGAGTAGG + Intronic
1185181772 22:49367711-49367733 ACATATAAATTCCAGAGAGTGGG - Intergenic
949395389 3:3609562-3609584 AAATATATATTATTGTGGGAGGG - Intergenic
950934742 3:16827114-16827136 ATATATAAAATACAGTAGAAAGG + Intronic
950956495 3:17058895-17058917 ACATATAAATGACAATGGATTGG + Intronic
951046484 3:18045210-18045232 ACATATAAGTCACATTGAGAGGG - Intronic
953460663 3:43079282-43079304 ACAGGTAAATTTCACTGGGATGG + Exonic
957010680 3:75002741-75002763 AGATGTTTATTACAGTGGGAGGG - Intergenic
957299104 3:78367682-78367704 AAATATAAATGATAGTAGGATGG - Intergenic
957564951 3:81873292-81873314 ATAAAAAATTTACAGTGGGAGGG + Intergenic
958528695 3:95295380-95295402 AAATGTATATTACAATGGGATGG + Intergenic
958542842 3:95501519-95501541 ACATAAAAATTACAGATAGAGGG + Intergenic
959786785 3:110308829-110308851 AGATATGAATTACAGTTTGAAGG + Intergenic
962137277 3:132748121-132748143 ACATATACAATACAGTGAAAAGG - Intergenic
962654608 3:137530560-137530582 AACTCTAAATTTCAGTGGGAAGG - Intergenic
964965762 3:162491128-162491150 ACATAAAAATTAGGGTGGGATGG - Intergenic
965222793 3:165949717-165949739 AAATATAACTTACACTGGGCAGG + Intergenic
966172965 3:177103110-177103132 ACAAATAAATCACACTGGGAAGG + Intronic
967686721 3:192425897-192425919 ACATTAAAATTACATGGGGATGG + Intronic
969093676 4:4716564-4716586 ACATATAAAATAAAATGGGCTGG - Intergenic
970181744 4:13404704-13404726 ATATATAAATGGCAGTGGTAGGG + Intronic
970372350 4:15420745-15420767 ACAAAGAAATGTCAGTGGGAAGG + Intronic
970519336 4:16866262-16866284 ACTTATAAACTACATTGGAAAGG + Intronic
971496425 4:27270785-27270807 AAATACAAATAACAGTGGGATGG - Intergenic
972789450 4:42357111-42357133 ACATATCTATTAGAATGGGAAGG + Intergenic
974113332 4:57550796-57550818 AAATAAAGAGTACAGTGGGATGG - Intergenic
974369965 4:61003261-61003283 ATATATAATATACAATGGGATGG + Intergenic
974583405 4:63836829-63836851 ACATATAAGCTACAGTAGTATGG + Intergenic
975447211 4:74479942-74479964 AAATATATATTCCAGTGGGAAGG + Intergenic
975607506 4:76170096-76170118 ACATATAAATTAACTTGGGTAGG + Intronic
976023337 4:80657800-80657822 ATCTATAAATTACATTGGGCAGG + Intronic
977254769 4:94728217-94728239 ACATCTAATTTAAAATGGGATGG - Intergenic
979088387 4:116445069-116445091 AAATATATACTACAGTGGCATGG + Intergenic
980143609 4:128952433-128952455 AAGTATATATAACAGTGGGAAGG - Intronic
980433197 4:132731074-132731096 ACATATGATTTAAAGGGGGATGG - Intergenic
981070824 4:140536262-140536284 ACTTAGAATTTACAGAGGGAAGG - Intronic
981313638 4:143320367-143320389 GCAGATAGATTCCAGTGGGATGG - Intergenic
981853399 4:149258085-149258107 ACATAATAATTATATTGGGAGGG - Intergenic
982076451 4:151742057-151742079 ACAGAAGAATTACAATGGGAAGG + Intronic
982340314 4:154291366-154291388 ATAAATAAATAACAGTGTGAAGG + Intronic
982450747 4:155549621-155549643 ACATATAAATTGGAGGTGGAGGG + Intergenic
982466682 4:155741164-155741186 TCATGTAAATTACAATGGAAAGG + Intergenic
982558821 4:156903145-156903167 ACATATGTATTACAGTGAAAAGG + Intronic
982628796 4:157804805-157804827 TTAAATAAATTATAGTGGGATGG - Intergenic
983632057 4:169859624-169859646 ACATATAAACAACAGTGAGGTGG - Intergenic
984196365 4:176662529-176662551 ACATATTAAATTCAGTGGCAGGG - Intergenic
984733622 4:183090666-183090688 ACATATAAATTGCAGGGGGGTGG - Intergenic
986391718 5:7293516-7293538 AAATATAAAATACAGTGGCCGGG + Intergenic
986812209 5:11372582-11372604 ACATATGAAGTACACAGGGATGG + Intronic
987613162 5:20235045-20235067 ACATATTAAAAACAGTTGGATGG + Intronic
987685001 5:21185557-21185579 AAAAATAAATTACATTTGGAGGG + Intergenic
988219338 5:28321889-28321911 AAATATAAATAGAAGTGGGATGG - Intergenic
988932306 5:36048325-36048347 ATATGCAAATTACAGTGGCAGGG + Intronic
988954789 5:36304471-36304493 ATATATCAGCTACAGTGGGATGG + Intergenic
990086415 5:51983566-51983588 ACATATAAATTAGGGAGGGGGGG + Intergenic
992239785 5:74755692-74755714 ACAGACAAATAACAGTGAGAAGG + Intronic
992710579 5:79450559-79450581 ACATATAAATTACTGTGTTTAGG - Intronic
993326840 5:86550212-86550234 CCATATAATTAACAGTGGGATGG - Intergenic
993636682 5:90352814-90352836 AAATAGATATTACAGTTGGAAGG + Intergenic
993996189 5:94726275-94726297 ACATACAACTTCCAGTGGGTGGG - Intronic
995238053 5:109852798-109852820 TCATATGATTTACAGTGGAAAGG + Intronic
995494683 5:112728425-112728447 ACATATAAAATACACTGGTCGGG - Intronic
998555875 5:143123226-143123248 ACATGTACATTACTCTGGGAAGG + Intronic
998658566 5:144209249-144209271 ACAAATAAATTTCAGTGTGTGGG - Intronic
999525955 5:152405546-152405568 ACATAGAAATTAAAGTTGCAGGG + Intronic
1001912613 5:175533588-175533610 AAATATAAACTAAATTGGGAAGG + Intergenic
1002357481 5:178642497-178642519 ACATATAAATTACATGAAGAGGG + Intergenic
1003308382 6:4948205-4948227 ACATAGATCATACAGTGGGAGGG - Intronic
1007661649 6:43490424-43490446 ACAGATGAACTAGAGTGGGAAGG + Intronic
1007835758 6:44672428-44672450 ACAAATAAATCACTGTGGCAAGG + Intergenic
1008513433 6:52298125-52298147 CCCTATAAATGACAGTTGGATGG + Intergenic
1011912490 6:92458701-92458723 ACATATTGATTCCAGTGGTAAGG + Intergenic
1012357901 6:98339214-98339236 ACATATAAATTATGTTGGAATGG - Intergenic
1012496361 6:99837562-99837584 AGCAATAAATTACATTGGGATGG - Intergenic
1013443895 6:110201330-110201352 ACATATAGATTTGAGTGAGAGGG + Intronic
1013976232 6:116081891-116081913 AGATTTACATTATAGTGGGAGGG + Intergenic
1015280350 6:131426870-131426892 ACAAATAAATTACAGGTAGAAGG + Intergenic
1015973360 6:138764773-138764795 AAATATAAATTAGAGGGTGAAGG + Intronic
1017611296 6:156189038-156189060 ACATAGAAAATAGAGTGGTATGG - Intergenic
1017696812 6:157023728-157023750 AAATAGAAATTACTGTTGGAGGG - Intronic
1019486974 7:1293929-1293951 AAATATAATTTACAGTGGGAAGG + Intergenic
1019720327 7:2566412-2566434 ACATATGCATTACAATGAGAAGG - Intronic
1020809688 7:12835674-12835696 ACATATAAATTTCATTTGTAAGG + Intergenic
1022265735 7:28752465-28752487 ACATATTAATTACAAAGAGAAGG - Intronic
1023151147 7:37202709-37202731 AAGTATAAATTACAGTAAGAAGG - Intronic
1024260342 7:47569554-47569576 ACATACATATTACACAGGGACGG + Intronic
1025027384 7:55527857-55527879 AAATATAAATTACAATAGTATGG + Intronic
1025880805 7:65534665-65534687 AAATATAAATTGAAGGGGGAGGG + Intergenic
1025892632 7:65667941-65667963 AAATATAAATTGAAGGGGGAGGG - Intergenic
1028375810 7:90145735-90145757 ACATATATATTTCAGTTGAAAGG - Intergenic
1028663180 7:93307593-93307615 ACAAATAAATTTCAGTGAGTAGG + Intronic
1028786543 7:94800819-94800841 ACACATAAATTAAATTGGAAAGG + Intergenic
1029824461 7:103174502-103174524 ACATATATATTTCAGTTGAAAGG + Intergenic
1030896246 7:115064116-115064138 ACATAAACATTACAGAGAGAAGG + Intergenic
1031211180 7:118828469-118828491 AAATATAAAATAAAGTGGCAAGG + Intergenic
1031560522 7:123232531-123232553 TCATATAAATTATAGTCTGATGG - Intergenic
1032945971 7:136853153-136853175 ACATTTAAATTTTAGTGGGGAGG - Intergenic
1033058919 7:138086293-138086315 ACAACCAAAGTACAGTGGGAAGG - Intronic
1034247746 7:149661740-149661762 AAATACAAAATACACTGGGAAGG - Intergenic
1034842145 7:154408833-154408855 ACATATAAATTTGAGTTGGGGGG - Intronic
1035854985 8:2964941-2964963 ACAAATAAAATACTGAGGGAGGG - Intronic
1036008078 8:4690164-4690186 ACATGTAAATAACACTGTGAGGG - Intronic
1036107004 8:5852141-5852163 ACATATAACTTAAAGAGGTAAGG - Intergenic
1036136130 8:6163250-6163272 ACATCAACATTACAGTGGGAGGG + Intergenic
1036913297 8:12778589-12778611 AGATAAAAATTACAGTGGGGAGG + Intergenic
1038881441 8:31618044-31618066 ACATATAACTCTGAGTGGGAAGG + Intergenic
1039409636 8:37342086-37342108 AAATGTAAATTACAGTAGAATGG - Intergenic
1042471189 8:69189768-69189790 ACATATAAATTATAGTGCAGTGG - Intergenic
1042676066 8:71323786-71323808 ACACATAAAGAACTGTGGGATGG + Intronic
1042758035 8:72239596-72239618 ACATAAAAATTAAATTGGCAAGG + Intergenic
1042796254 8:72666345-72666367 ATATATAAAATAAAGTGGAAGGG - Intronic
1042934425 8:74044483-74044505 ACATATTACATACATTGGGATGG - Intergenic
1045633825 8:104159467-104159489 ACCTATAAATTACCTTGGGCAGG + Intronic
1046282077 8:112046496-112046518 AAATGTAAATTACAGTGCAATGG - Intergenic
1046289845 8:112143753-112143775 ACACTGAAATTACAGTGGGAAGG + Intergenic
1046369088 8:113276609-113276631 AAATAAAAATTTCAGTGGGCTGG - Intronic
1046717039 8:117579328-117579350 CCATATAAGTTACAGTGGGTTGG + Intergenic
1047436201 8:124837319-124837341 ATTTATAAATTACAATGAGAAGG - Intergenic
1048445481 8:134489748-134489770 ACATTTAAATTTCAGGGGAAGGG - Intronic
1049991490 9:995950-995972 TCATTTAAATCACAGTGGCAGGG - Intergenic
1050288315 9:4127419-4127441 AGATATAAACTGCAATGGGAGGG - Intronic
1051123650 9:13779150-13779172 AGATGTATTTTACAGTGGGATGG + Intergenic
1052221763 9:26032497-26032519 ACATATAAATTTGGGAGGGAGGG + Intergenic
1052463426 9:28797597-28797619 ACATATAAAATGCTGTGAGAAGG + Intergenic
1053709572 9:40792056-40792078 CCATATTGATTATAGTGGGAAGG + Intergenic
1054419476 9:64912844-64912866 CCATATTGATTATAGTGGGAAGG + Intergenic
1055122549 9:72678989-72679011 AAATATAGACTTCAGTGGGATGG - Intronic
1055260050 9:74423696-74423718 ATTGATAAATTACAGTGAGATGG - Intergenic
1055659576 9:78489564-78489586 ACAAATAAATTATAGTGAGTAGG + Intergenic
1057224355 9:93281542-93281564 ATATAGAGATTACAGTGAGATGG + Intronic
1057268228 9:93632720-93632742 ACAGATAAATTTTGGTGGGATGG + Intronic
1058271789 9:102981579-102981601 ACATCCAAATTACAATGGTAGGG - Intergenic
1059999010 9:119941674-119941696 ACATATGAATTTGTGTGGGAGGG - Intergenic
1060801694 9:126549233-126549255 ATATATAAATGGCAGTGGGTGGG + Intergenic
1061695034 9:132366970-132366992 ACATATAAAACTCAGTGGAACGG - Intergenic
1185919337 X:4072511-4072533 AAATAAAAATTTCAGTGAGAAGG + Intergenic
1187994960 X:24916197-24916219 ACAGAAAATTTACAGTGGAATGG + Intronic
1188235454 X:27724846-27724868 ACATATACTTTAAAGTGAGAGGG + Intronic
1188379468 X:29473366-29473388 ATATATAAATTTGAGAGGGATGG + Intronic
1188571057 X:31585355-31585377 ACATATAAACTCCAGAGGGTGGG + Intronic
1188878434 X:35461745-35461767 ACATAAATATTTCTGTGGGATGG - Intergenic
1189047876 X:37612334-37612356 ACATATAAATCACATGGGGAAGG - Intronic
1189842169 X:45092102-45092124 AAATATAATTTATAGTGGGGTGG + Intronic
1190359486 X:49635553-49635575 ACATCTGAATTGCAGTGGGGTGG + Intergenic
1190829726 X:54048811-54048833 GCATTTACATTACAATGGGATGG - Intronic
1190885928 X:54530873-54530895 ACATTTAATATACAGAGGGAGGG + Intronic
1193442072 X:81554550-81554572 ATATATACATGAAAGTGGGATGG + Intergenic
1195750067 X:108155547-108155569 ACTCATAAATTGCAGTGAGATGG + Intergenic
1195869599 X:109472342-109472364 ACATACAAAATACAGTGGAAAGG - Intronic
1196204551 X:112924469-112924491 ATCTATAAATTACCTTGGGAAGG + Intergenic
1197752477 X:129974967-129974989 ACATATAAAAAGCTGTGGGAGGG + Intergenic
1201601643 Y:15735906-15735928 ACTTAAAAATAACAGTGGCAAGG + Intergenic