ID: 909352749

View in Genome Browser
Species Human (GRCh38)
Location 1:74673660-74673682
Sequence CGCCGCCGCCCCTGGGCGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 440}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909352740_909352749 5 Left 909352740 1:74673632-74673654 CCCCTGTGCGCGGGCACCTGGGC 0: 1
1: 0
2: 2
3: 12
4: 179
Right 909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG 0: 1
1: 0
2: 5
3: 52
4: 440
909352737_909352749 12 Left 909352737 1:74673625-74673647 CCGAGGTCCCCTGTGCGCGGGCA 0: 1
1: 0
2: 0
3: 6
4: 88
Right 909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG 0: 1
1: 0
2: 5
3: 52
4: 440
909352741_909352749 4 Left 909352741 1:74673633-74673655 CCCTGTGCGCGGGCACCTGGGCT 0: 1
1: 0
2: 1
3: 11
4: 116
Right 909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG 0: 1
1: 0
2: 5
3: 52
4: 440
909352734_909352749 17 Left 909352734 1:74673620-74673642 CCGCACCGAGGTCCCCTGTGCGC 0: 1
1: 0
2: 0
3: 4
4: 94
Right 909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG 0: 1
1: 0
2: 5
3: 52
4: 440
909352742_909352749 3 Left 909352742 1:74673634-74673656 CCTGTGCGCGGGCACCTGGGCTG 0: 1
1: 0
2: 1
3: 8
4: 179
Right 909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG 0: 1
1: 0
2: 5
3: 52
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909352749 Original CRISPR CGCCGCCGCCCCTGGGCGCC CGG Exonic
900150816 1:1178715-1178737 TGCGGCCGCCCCTGGGTGCCAGG - Intronic
900205189 1:1428355-1428377 TGCCGCCACCCCTGGGCTTCTGG - Intergenic
900207306 1:1437038-1437060 CTCCACTGCCCCTGGGCACCGGG + Exonic
900233478 1:1574711-1574733 CCCCGCCCACCCTGGGCGCCGGG + Exonic
900438823 1:2643443-2643465 AGCCGCCTCCTCTGGGCTCCGGG + Intronic
900483180 1:2909243-2909265 CTGCCCAGCCCCTGGGCGCCTGG - Intergenic
900513025 1:3069339-3069361 GGCCGCCGGGCCGGGGCGCCCGG + Intronic
900633269 1:3649857-3649879 CGCCCCCGGCCCTGCCCGCCGGG + Intronic
900710155 1:4108463-4108485 CGCCCCCGCCCCGGGGCACATGG - Intergenic
901057528 1:6455588-6455610 CGCCGCCGTCCAGGGGCGGCAGG - Intronic
901641522 1:10695225-10695247 CGTCCCCGGCCCTGGGCCCCAGG + Intronic
902247307 1:15129339-15129361 CGCCTCCTCCTCTGGGTGCCAGG + Intergenic
902585661 1:17437779-17437801 CGCCCCCTCCCCGCGGCGCCCGG + Intronic
902600887 1:17539676-17539698 CGGCGCCGCCCCCGCCCGCCCGG - Intergenic
904696514 1:32334728-32334750 CGCAGCCACCCCTGAGAGCCAGG - Exonic
904744470 1:32702630-32702652 CCCCGCCGCGCCGGGGCTCCGGG + Exonic
904822946 1:33256816-33256838 CGCCGCCGCCGCTCTGGGCCGGG - Intronic
905569329 1:38991438-38991460 CGCCGCCGCTTCGGGGAGCCGGG - Exonic
905626220 1:39491932-39491954 CGCCGCCGCCCCTGGGCCCGGGG - Exonic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
908501104 1:64744890-64744912 CGCGGGCGCGCCTGTGCGCCGGG + Intergenic
908501185 1:64745146-64745168 GTCCGCAGCCGCTGGGCGCCCGG + Exonic
908563090 1:65326583-65326605 CTCCACTGCCCCTGGGCCCCAGG - Intronic
908581912 1:65525537-65525559 CGCAGCCGCCCCTGAGCGGGAGG - Intronic
909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG + Exonic
909433553 1:75616067-75616089 CGCCGCCGCCCCTCTGCTCTCGG + Intergenic
912633591 1:111270787-111270809 TGACGCCGCCCCTGGCTGCCTGG + Intergenic
913144541 1:115976542-115976564 CGCGGCAACCCCTGGGCGCCCGG - Exonic
913518264 1:119623296-119623318 CGCCGCCGCCCCCGCGCCGCTGG + Exonic
914702992 1:150150510-150150532 CTCCCCCGCCCCCGGGCGCCGGG + Intronic
914808376 1:151008407-151008429 CGCCTCCGCCGCTGGGGGCGGGG + Intronic
917876839 1:179293816-179293838 CGTTGCGGGCCCTGGGCGCCAGG + Exonic
919748663 1:201023590-201023612 CGCCGCCGCCCGATGGCGCGAGG - Exonic
920385747 1:205569318-205569340 CGCCCCCGCCCCGCGGCCCCCGG + Intronic
921390536 1:214609085-214609107 GGCCCGCGCCCCTGGGCCCCAGG + Intronic
921850515 1:219928443-219928465 CGCCACCAGCCCCGGGCGCCCGG + Exonic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
922950899 1:229558210-229558232 CGCAGCCGCCCCTTGTCCCCGGG + Exonic
922950909 1:229558236-229558258 CGCCGCCGGCCCGCGCCGCCAGG + Exonic
923108101 1:230869202-230869224 TCCCGCCGCCCCTCGGGGCCAGG + Intronic
924775162 1:247111338-247111360 CGCCGCAGCCCCAGCGCGCGGGG + Exonic
924841313 1:247712309-247712331 CGCAGCTGGCCCTGGGCTCCTGG - Exonic
1063371035 10:5523377-5523399 CCACGCCACCCCTGGGCCCCAGG + Intergenic
1063664094 10:8051499-8051521 CGCCGCCGCCGCAGGGCCCGGGG - Intergenic
1063977807 10:11430997-11431019 AGCAGCCGCCCCTGGGCCCGTGG - Intergenic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1064981925 10:21174008-21174030 CGCGGCCGGCCCCAGGCGCCAGG - Intronic
1067145213 10:43689342-43689364 CGCCGCCTCGCCTGGGCAGCTGG - Intergenic
1067436931 10:46284901-46284923 CGCCGCCGCCCTCTGGCTCCTGG + Intergenic
1068560851 10:58512979-58513001 CGCCGCCGCCACTGAGCCCCCGG - Intergenic
1068910506 10:62374326-62374348 CCCCGCCGCACCTCCGCGCCGGG - Exonic
1069474565 10:68721384-68721406 CGTCGCCGCCCGGGGCCGCCGGG - Intronic
1069521451 10:69124474-69124496 CGCCGCCGCCCGTAGGTGCTCGG - Intronic
1070568271 10:77620258-77620280 GGCCGCCGGGCCTGGCCGCCAGG + Intronic
1072591413 10:96832044-96832066 TGCCGCCGCCTCTGGCCGCCCGG - Intergenic
1072915540 10:99535511-99535533 CGCCGCCGCCGCCGCCCGCCGGG - Exonic
1073121185 10:101123393-101123415 TGCGGGCGGCCCTGGGCGCCCGG - Intronic
1074121556 10:110497621-110497643 CACCGCGGCCCCGGAGCGCCTGG + Intergenic
1075032197 10:119030693-119030715 CGGCGGCGACCCTGGGCGGCCGG - Exonic
1075699756 10:124461786-124461808 CGCGGCCGCGCAGGGGCGCCTGG - Intergenic
1075748431 10:124743982-124744004 CGCCGCCGCCGCCCGGCCCCGGG + Intronic
1076035604 10:127196510-127196532 CGCCCTCGCCTCTGGCCGCCCGG - Intronic
1076655614 10:132021688-132021710 TGCAGCCGCCCCTGTGCACCTGG - Intergenic
1076656144 10:132024959-132024981 TACCACGGCCCCTGGGCGCCTGG - Intergenic
1076721980 10:132396862-132396884 CCCCGCCGCCCCCGGGCTCGTGG + Intergenic
1076837212 10:133027187-133027209 TGCCGCCGACCCTGTGAGCCTGG + Intergenic
1076837221 10:133027219-133027241 TGCCGCCGACCCTGTGAGCCTGG + Intergenic
1077090833 11:777534-777556 CGGCTCCGCCCCCGGCCGCCAGG - Intergenic
1077200262 11:1303356-1303378 CGTGGCAGGCCCTGGGCGCCGGG + Intronic
1077214626 11:1390250-1390272 CGGCGCCGGCCAGGGGCGCCCGG - Intronic
1077360857 11:2139566-2139588 CGCCCCCCCCCCGGGGCCCCAGG - Intronic
1078246052 11:9573959-9573981 CGCCGCCACCCCGCCGCGCCGGG + Exonic
1078594675 11:12675278-12675300 CGCCGCCGCCCCCCGGCGCCGGG + Intronic
1078771803 11:14358722-14358744 CGCCGCCGCTCCGGCGCCCCGGG + Intronic
1080012436 11:27472368-27472390 CCCCGCCGCCCCCGGGCAGCCGG + Exonic
1080386261 11:31812888-31812910 CGCCGCAGCCCCTGGCAGCCGGG + Intronic
1080677118 11:34438685-34438707 CCCCGCCGGCCCGGGGTGCCCGG - Intergenic
1082810479 11:57476512-57476534 CGCCACCCCCCCGGAGCGCCAGG + Exonic
1083272872 11:61580882-61580904 CGCCGCCGCCGCTGGGCATGGGG + Intronic
1083476991 11:62921299-62921321 CGCAGCTCCCCCTGGGAGCCAGG - Exonic
1083571296 11:63763453-63763475 CGCCGCCGTCACGCGGCGCCGGG + Exonic
1083596258 11:63919426-63919448 CCCCGCAGCCCCGGGGCGGCAGG - Intergenic
1083992974 11:66258011-66258033 CGCCCCCGCCCCGGGCCACCCGG - Intronic
1084146215 11:67266638-67266660 CGCCGCCGCTCCTGCTCGCTCGG - Exonic
1084174293 11:67415609-67415631 CGCCGCCCCCGCTGGGCACTGGG + Intronic
1084371796 11:68750232-68750254 CGGTGTTGCCCCTGGGCGCCTGG - Exonic
1084480023 11:69414829-69414851 CCCCGACACCCTTGGGCGCCCGG + Intergenic
1084538901 11:69774709-69774731 CGCCCCCGCCCCTTCGCGCCTGG + Intronic
1084539040 11:69775225-69775247 CGACGGGGCCCCCGGGCGCCGGG + Exonic
1084888117 11:72223827-72223849 CCGCGCCGCCCCGGGGAGCCGGG - Intronic
1087785257 11:102347159-102347181 AGCCGCCGCGCGAGGGCGCCCGG - Intergenic
1088172954 11:107018252-107018274 CGCCGCCGCACCTTGGGGCCCGG + Exonic
1088462234 11:110093511-110093533 CGGGGCCGCGCCCGGGCGCCAGG + Intronic
1089454538 11:118618315-118618337 CTCCCCCTCCCCTGGGCTCCAGG + Intronic
1089729467 11:120511534-120511556 CGCCCCCGCGCCTGGGCTCCCGG + Intergenic
1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG + Exonic
1091689027 12:2583265-2583287 CGCCGCGGCCCCAGGGCAGCCGG - Intronic
1091778737 12:3200750-3200772 GGCAGCAGCCCCTGGGCGCGGGG + Intronic
1092615513 12:10212794-10212816 CACCCCCTGCCCTGGGCGCCTGG + Exonic
1093931137 12:24956095-24956117 CGCCCCCGCCCCGGGGAGCTGGG + Intergenic
1095581620 12:43806414-43806436 CGCCGCCCTTCCTGGCCGCCGGG + Intergenic
1096622684 12:52874327-52874349 CGGCGCCGCCCTGGGGCCCCCGG - Intergenic
1096717411 12:53499676-53499698 GGCCCCCGCCCCTGGCCCCCCGG + Intronic
1096981077 12:55728561-55728583 CCCCGCCGCCTCTGGGGCCCAGG + Intronic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097019090 12:56007545-56007567 CACCGCCGCCTCTGAGCGCCCGG + Intergenic
1097929626 12:65169829-65169851 CGCCGCCGCCGCTGGTCCCGCGG - Exonic
1099365117 12:81758851-81758873 CGCCGCTCCCCCTCCGCGCCCGG + Intronic
1100468980 12:94873610-94873632 CGCCGTCGCCCCGGGGTGCGGGG - Intergenic
1103379765 12:120485023-120485045 AGCCACCGCCCCTGGCCGCATGG + Intronic
1103392546 12:120584832-120584854 CGCCGCTGCCCCTTCGCGGCCGG - Intergenic
1103405034 12:120669072-120669094 CGCAGCCTCCCCTGGCTGCCTGG - Intergenic
1103474811 12:121210435-121210457 AGCCGCCGCGCCGGGGCCCCGGG + Intronic
1103509923 12:121467259-121467281 CGCCGCCGCCGCCGCCCGCCCGG + Intronic
1103779357 12:123389013-123389035 CGCGGCAGCCCCGGGCCGCCCGG - Intronic
1104021263 12:124993878-124993900 CCCCGCGCCCCCTGCGCGCCCGG - Exonic
1105217446 13:18297499-18297521 CGCGGCAGCCCCGGGCCGCCCGG - Intergenic
1107604025 13:42040805-42040827 CGCCGCTGCGCCGGGGCTCCTGG - Intronic
1110318403 13:74134967-74134989 GGGGACCGCCCCTGGGCGCCGGG + Intergenic
1110630187 13:77698180-77698202 CGCCGCGGCCTCAGGGGGCCTGG + Intronic
1111950771 13:94707488-94707510 CGCCGGCGCTCCCGGCCGCCTGG - Intergenic
1112324465 13:98434195-98434217 CGCCCCTGCCCCTGAGCACCGGG + Intronic
1112509431 13:99997071-99997093 CGCGCGCGCCCCTGGGCGCAGGG + Intergenic
1113378916 13:109786083-109786105 CGCCCCAACCCCTGGGCGCCGGG - Exonic
1113437809 13:110307060-110307082 CGCCGCGGCCCCCGCACGCCGGG - Exonic
1113546182 13:111153298-111153320 CACCGCCGCCTCTTGGCGCCAGG - Intronic
1116905087 14:50396634-50396656 CGCCGCCTCCGCGGGGAGCCGGG - Intronic
1118339092 14:64879818-64879840 CGCCGCCACCCCCGGGCTCGGGG - Exonic
1118776852 14:68978830-68978852 CGCCCCCTCCCGTGCGCGCCCGG + Intronic
1119260902 14:73237620-73237642 GGTCCCCGCCGCTGGGCGCCCGG - Intronic
1119519745 14:75277271-75277293 AGCCGCCGCGCCCGGGAGCCAGG - Intergenic
1121089510 14:91171432-91171454 CACCTCTGCCCCTGGGCTCCAGG + Intronic
1122065820 14:99174021-99174043 TGCCGCCTCCCCTGGGCCCCGGG + Exonic
1122904514 14:104795631-104795653 TGCCGCCGCCGCTCGGTGCCCGG + Intronic
1123023862 14:105414622-105414644 CGCCGCCGCCTCTGCCCACCAGG - Intronic
1123162051 14:106287743-106287765 TGCGGCGGCCCCTGCGCGCCTGG + Intergenic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1126738054 15:51751623-51751645 CGGCGCCGCCCCTGTTCTCCCGG + Exonic
1127763628 15:62164588-62164610 CGCCGCCGCAGCTGTGGGCCCGG + Exonic
1128982372 15:72197180-72197202 CGCGGCCTCCCCCGGGCGCCAGG - Intronic
1129115202 15:73361771-73361793 AGCAGCCGCCCCTGGGGGCTGGG - Intronic
1129162186 15:73753072-73753094 CTCAGCAGCCCCCGGGCGCCGGG + Intergenic
1129668255 15:77591856-77591878 CCCCGCCGACCCTGGGCTACCGG - Intergenic
1129799816 15:78405615-78405637 CCCGGCCGCCCCTGAGCACCCGG + Intergenic
1131059465 15:89395713-89395735 CGCCGCCGTCCCTGTGCAGCTGG + Intergenic
1131094550 15:89647277-89647299 CGCCGCCACCAGAGGGCGCCAGG + Intronic
1131171929 15:90184965-90184987 CGGCGCAGCCCCTGGGGACCCGG - Intronic
1131184939 15:90265935-90265957 GGCCGCGCCCCCTTGGCGCCGGG + Intronic
1131827200 15:96331266-96331288 CGCCGCCTGCCCCGGGCGTCCGG - Exonic
1132544508 16:527202-527224 CACCGCCGCTCTTGGCCGCCAGG + Intergenic
1132587488 16:711886-711908 CGCCGCCACCAGAGGGCGCCTGG + Intronic
1133005989 16:2882340-2882362 TGCCACCGCCCCAGGGCTCCAGG - Intergenic
1133029728 16:3004649-3004671 CGCCTCAGCCCCTGGGCCCGTGG + Intergenic
1133059168 16:3163398-3163420 AGCCCCCGCGCCTGCGCGCCCGG + Intergenic
1133063740 16:3191761-3191783 CGCCCCCGCCCCTCTGCCCCTGG - Intergenic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133272032 16:4614978-4615000 CCCCGCTCCCCCGGGGCGCCCGG - Intronic
1134290529 16:12900786-12900808 CGGCGCCGCCTCTGCGCTCCCGG - Intergenic
1135821887 16:25692388-25692410 CGCCGCCGCCGCCGCGAGCCGGG + Exonic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1136500882 16:30669240-30669262 CGCAGCAGCCACTGGGCCCCAGG + Exonic
1137261121 16:46830956-46830978 CGCCGCCGCCGGCGGGCCCCAGG + Intronic
1137426442 16:48384966-48384988 CGCCCCCGCCCCTGGAGCCCCGG - Intronic
1137988718 16:53131323-53131345 CGCCGCCGCCGCTGCTCGGCCGG + Intronic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139371085 16:66469872-66469894 CGCCGCCCACCCTGGGGCCCTGG + Exonic
1139468079 16:67164698-67164720 CTACTCCGCCCCGGGGCGCCGGG - Exonic
1139546705 16:67653113-67653135 CCCTGCCGCCCCTGGGCCCCCGG + Exonic
1139615444 16:68085755-68085777 CGCCGCCGCCCCCGGGCTCGCGG + Exonic
1139826664 16:69762490-69762512 AGCCGCCGCCCCCCGACGCCCGG - Intronic
1141585068 16:85028109-85028131 CCCCTCCGCCCGTGGGCTCCCGG - Intronic
1141741867 16:85898922-85898944 CAGCGCCGCCCCTGGACCCCAGG + Exonic
1142177283 16:88651050-88651072 CACTGCCGCCCCTGCGCTCCCGG + Exonic
1142395345 16:89828556-89828578 CGCCGCCGCAGCTGCCCGCCCGG - Exonic
1142430358 16:90022979-90023001 CGCCGCCGACCCCGGGCCCTGGG - Intronic
1143007511 17:3846358-3846380 CGCCGCCGCCCCCTGGTGGCGGG + Intergenic
1143166414 17:4899325-4899347 CGCCGCCGCCCGAGGCCCCCCGG - Exonic
1143724034 17:8833147-8833169 CTCCGCTGCCCCTGGGGGCCCGG + Intronic
1144787506 17:17840200-17840222 CGGCGCAGCCAATGGGCGCCCGG + Intergenic
1145750176 17:27349601-27349623 CGCCCCCGCCCCAGGCCGCGAGG + Intergenic
1146034033 17:29390642-29390664 CGCCGCGGCCCCTCGGCGGGCGG - Exonic
1146401584 17:32504206-32504228 CGCCCCCGGGCCTGGGAGCCAGG - Intronic
1148262241 17:46193556-46193578 CGCCGCCCCCGCGGGCCGCCAGG + Intronic
1148397733 17:47323819-47323841 CGCCACCGCCCAGGGGCTCCGGG - Intronic
1148606738 17:48935226-48935248 TGCCACCGCGCCTGGCCGCCTGG - Intronic
1148787200 17:50151115-50151137 CGCAGCCGCCGCTGGGGGACTGG + Intergenic
1149038366 17:52158871-52158893 TGCCTCCGCCCCCGGGTGCCGGG - Intronic
1149614760 17:57988322-57988344 CGCCGCCGCCCCCAGTCGCCCGG + Intergenic
1149678499 17:58487738-58487760 CGCCGCCGCCCGCGGGGCCCCGG - Exonic
1149994637 17:61400141-61400163 GGCCCCGGCCCCCGGGCGCCTGG + Exonic
1150060617 17:62065436-62065458 CGCCTCCGGCCCTCGGCCCCGGG - Intergenic
1151559169 17:74861553-74861575 CGCCCCCGCCCCGCCGCGCCCGG - Intergenic
1151743689 17:76000704-76000726 CACCCCAGCCCCTGGGCCCCTGG - Intronic
1151886182 17:76924497-76924519 CTCAGCCAGCCCTGGGCGCCAGG + Intronic
1152617016 17:81342726-81342748 GGCCGCAGACCCTGGGCGCCCGG + Intergenic
1152627421 17:81393948-81393970 CTCCGCCGCACCTCGGCTCCCGG + Intergenic
1152831138 17:82497517-82497539 CGCCGCCCTCCCTCGGCGCTCGG + Intergenic
1153238923 18:3013379-3013401 CGCCCCCGCCGCCGAGCGCCAGG + Intergenic
1153565651 18:6414891-6414913 CGCCGCTGCCCCGCGGTGCCCGG + Intronic
1155054568 18:22172041-22172063 CGCGGCCGCCCATGGCCGCCAGG - Exonic
1155570346 18:27185376-27185398 CGCCCCCGCCCCCGCCCGCCCGG + Intergenic
1155928810 18:31685100-31685122 CGCGGCGGCCGCGGGGCGCCGGG - Intronic
1155928953 18:31685612-31685634 CACCGCCGCCCCCGCCCGCCCGG + Intronic
1156350379 18:36297499-36297521 CGCCGCCGGCCTTTGGCGCAGGG + Intergenic
1157095099 18:44680204-44680226 CGCCGCCGCCTCCGCGCGCCCGG + Intronic
1157095107 18:44680215-44680237 CGCCGGGGCCCCCGGGCGCGCGG - Intronic
1157533399 18:48441123-48441145 CCCCGCCACCCCTGGGCTCAGGG + Intergenic
1157613800 18:48975556-48975578 CGCCGCCACCCCGGCGCGCACGG + Intergenic
1158464280 18:57675989-57676011 AGCCACTGCCCCTGGGCCCCTGG + Intronic
1158954165 18:62523606-62523628 CGCCGCCGCCCCGGGGACTCGGG + Exonic
1158954699 18:62526615-62526637 CGCCGCCGCCGCCGCGCACCCGG + Intronic
1160163166 18:76491163-76491185 CTCCGCCGCGCCTCGGCCCCCGG + Intronic
1160394615 18:78562749-78562771 CACCGCCTCGCCTGGGCACCCGG + Intergenic
1160597688 18:79988479-79988501 CCCCGCCGCCCCCGGGCCCACGG + Exonic
1160719059 19:589741-589763 CGCCGCCTCCGCTCGGCGCCGGG - Intergenic
1160789659 19:917609-917631 CGCCGCGGGCCGTGGACGCCTGG + Exonic
1160791782 19:926663-926685 CACCGCGGCCCCCGGGCGCCGGG + Intronic
1160791834 19:926819-926841 CGGCGCCGGCCCCGGGCGGCGGG + Intronic
1160810439 19:1010794-1010816 AGGCGCCGCCACTGGGCCCCGGG - Exonic
1161059755 19:2209082-2209104 CCCTGCCGCCCCTCGGGGCCCGG + Intronic
1161215819 19:3094597-3094619 CGCCGCCGCCCCCCGGCCCCCGG - Exonic
1161239511 19:3214270-3214292 AGCCACCGCGCCTGGGCCCCTGG + Intergenic
1161422599 19:4184160-4184182 GGCGGCCGCCCCAGGGGGCCGGG - Intronic
1161453598 19:4359717-4359739 CACCGCTGCCCCTGGGAGCCAGG + Intronic
1161952819 19:7477225-7477247 GGCCGCCGGCCCGGGCCGCCTGG + Exonic
1162017479 19:7853340-7853362 TGTCCCCGCCCCTGGGCCCCTGG - Intronic
1162312065 19:9913699-9913721 CCACGCCCCCCCGGGGCGCCTGG - Intronic
1162778729 19:12995870-12995892 GGCCGCCGCCCCCGCGCGACCGG + Intronic
1163104148 19:15113999-15114021 CGCCTTAGCCACTGGGCGCCCGG - Exonic
1163427005 19:17245506-17245528 CGCCGGGGCCCCAGGGCGGCGGG - Exonic
1163708554 19:18832095-18832117 CGCTGTCGCCCCCGCGCGCCCGG - Exonic
1165058651 19:33194482-33194504 CGCCGCTGCCCCCGCGCCCCGGG - Intronic
1165080409 19:33303146-33303168 CGGCGCCGCCCATGGGACCCCGG - Intergenic
1165401601 19:35604351-35604373 AGCCACCGCGCCTGGCCGCCCGG + Intergenic
1165772867 19:38388771-38388793 CGTCGCCGCCGCTCGGAGCCCGG + Intronic
1165859397 19:38899421-38899443 CGCGGCCACCCTTGGGCCCCGGG + Intronic
1166782694 19:45350711-45350733 CGCCGCCTCGCCTCGGAGCCGGG - Exonic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167306827 19:48714473-48714495 CGCCGCCGCGCATGCGCTCCAGG + Exonic
1167557120 19:50203532-50203554 CGGCCCCGCCCCTGGGGGACGGG - Intronic
925009146 2:468613-468635 CTGCACCGCCACTGGGCGCCTGG + Intergenic
925984958 2:9207551-9207573 CGCCGCCGCCCGCCGCCGCCCGG + Intronic
926217096 2:10912351-10912373 CGCCGCTGCCGCTGGGGGTCCGG - Exonic
926914340 2:17878504-17878526 CGCCCTCGGCCCGGGGCGCCCGG + Intronic
926982212 2:18584483-18584505 GCCCGCCGCCCCTGGCAGCCGGG - Intronic
927083816 2:19655092-19655114 CACTGCCACCCCTGGGCTCCTGG - Intergenic
928964874 2:36966491-36966513 TGCCTCCGCTGCTGGGCGCCGGG - Intergenic
929107202 2:38376999-38377021 CGCCGCCGCGCCTGCCCGCCGGG - Intronic
929452703 2:42047868-42047890 CGCCGCCCCCTCCGGCCGCCCGG - Intergenic
931602531 2:64019028-64019050 GGCCGCCGCCGCCCGGCGCCCGG + Exonic
931694176 2:64859724-64859746 GGCTGCCGCCCCAGGGCGCCCGG - Intergenic
931882170 2:66578648-66578670 CCCCGGAGCCCCTGGGCTCCTGG + Intergenic
932567672 2:72919933-72919955 CAACTCGGCCCCTGGGCGCCAGG - Intronic
932567744 2:72920168-72920190 CGCCCCCGGCCCTCGGCGCCCGG - Intronic
932725802 2:74178783-74178805 GGCCGCCGCCGCTCGGAGCCGGG + Exonic
932779061 2:74548923-74548945 CGCCGCCGTCCCCGGGCCCCCGG + Intronic
933491028 2:82985845-82985867 AGCCGCCTCCCCTGGGGGCAGGG - Intergenic
933791826 2:85889096-85889118 GGCCCCCGCCCCCGGGCGCGCGG + Intergenic
938406329 2:131035113-131035135 CGGCGCGGCCCCGCGGCGCCCGG + Intronic
942046519 2:172102301-172102323 CGCCGCCGCCGCCGCCCGCCGGG + Exonic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
943571511 2:189580777-189580799 CGCCGCCGCCGCCGTGGGCCGGG + Exonic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
944675846 2:202033872-202033894 CGCCGCCGCCGCCGCCCGCCGGG - Intergenic
946196158 2:218033988-218034010 CGTCTCCGCCCCTGCCCGCCGGG - Intergenic
946397037 2:219448417-219448439 CGCCGGCGCCCCTGCGGCCCTGG + Exonic
947399064 2:229714395-229714417 CCCCGCCGCGCCCAGGCGCCCGG - Exonic
948140476 2:235669506-235669528 CGCCGCCGCCGCCGCGCTCCCGG + Intronic
948689048 2:239690709-239690731 CTCCGCCCCCCCGGGACGCCGGG - Intergenic
948889386 2:240899562-240899584 CGCTGCCCCGCCTGGGCTCCAGG + Intergenic
1168757241 20:325965-325987 GGCCGCCGCCCCCGGGACCCGGG + Exonic
1169214736 20:3786519-3786541 CGCCGCCGCCCCGGGGCGGGGGG + Exonic
1170119431 20:12895576-12895598 CCCCGCTGCCACTGGGCACCTGG - Intergenic
1170460557 20:16573378-16573400 CGCCCCCGCCCCTCTGCTCCCGG + Exonic
1170558049 20:17531239-17531261 CGCCGCCGAGCCCGAGCGCCCGG - Exonic
1170629816 20:18057103-18057125 CTCCGCCGCTCGTGGCCGCCCGG - Intronic
1170655956 20:18288200-18288222 CGGCCCCGCCCCTTGGCGCGCGG - Intergenic
1170756838 20:19212571-19212593 CGCCGCCGCCTCCCGGCGCTCGG - Intergenic
1171186323 20:23126659-23126681 CGCCCCCACCCCCGGGAGCCTGG + Intergenic
1172100887 20:32483549-32483571 CGCTGCCGCCGCTGCTCGCCTGG - Intronic
1172587269 20:36093477-36093499 CGCCGCCGCCGCTGGGAGCTGGG + Intronic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1172914771 20:38435204-38435226 CTCCGCCGCCACTCGACGCCAGG - Intergenic
1173279978 20:41618787-41618809 CGCCGGCGCCCGAGCGCGCCAGG - Intergenic
1173454158 20:43189991-43190013 CGCCGCCGCCGCCGCCCGCCCGG + Intergenic
1175911511 20:62407334-62407356 CGCCGCGGCCAATGGGCGGCGGG - Intergenic
1176178730 20:63740042-63740064 CGCCCCCGCCCACCGGCGCCCGG - Intronic
1176207114 20:63895206-63895228 CGCCGCCGCCCGGGGTCTCCAGG + Exonic
1176382283 21:6119473-6119495 CCAGGCCGCCCCTGGGTGCCGGG + Intronic
1176550059 21:8217092-8217114 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176568986 21:8400127-8400149 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176576900 21:8444362-8444384 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1178854576 21:36239711-36239733 CGCAGCCACCCCTGTGCGCCAGG - Intronic
1178922591 21:36748123-36748145 CGCCGCAGCCCCGGGAGGCCGGG - Exonic
1178992502 21:37367304-37367326 AGCAGCCGCCGCTCGGCGCCCGG + Intronic
1179511999 21:41879343-41879365 CGCCGCCGCCCCCCGGCTTCCGG - Exonic
1179627431 21:42656573-42656595 CGCTGCAGCCACTTGGCGCCAGG + Intronic
1179741189 21:43418766-43418788 CCAGGCCGCCCCTGGGTGCCGGG - Intronic
1179968130 21:44818391-44818413 GGCCGCCGCCCATGGCCGCAGGG + Intronic
1180064337 21:45405132-45405154 AGCCGCCGCCGCTGGGAGGCCGG - Intronic
1180960679 22:19761032-19761054 CGCCGCCGCCCCCGGCGCCCCGG + Exonic
1181590578 22:23882662-23882684 CGCCGCACACCCTGGGCCCCGGG + Intronic
1182280626 22:29216103-29216125 CCCCCCCACCCCTGGGCTCCAGG + Intronic
1182429012 22:30289373-30289395 CGCCGCAGCCGGTGCGCGCCCGG - Exonic
1183486236 22:38089068-38089090 TGCCCCCGCCCCGGGGCGGCAGG - Intronic
1183486387 22:38089462-38089484 CGCCGCCCCCCGCGGGGGCCCGG - Intronic
1183683682 22:39349919-39349941 CGCCCCCTCCCCTGCGCGCGCGG - Intronic
1184557426 22:45240899-45240921 CGCCGCCGCCCGCGCGCCCCCGG + Intergenic
1184766972 22:46577181-46577203 CCCCGGCGCCGCTGGGCTCCCGG + Intronic
1184807323 22:46803460-46803482 CGCCTCAGCTCCTGGGGGCCGGG - Intronic
1184856760 22:47150567-47150589 CGCCTCTGCACCTGGGTGCCTGG + Intronic
1184863431 22:47189713-47189735 CGCAGCCCCTCCTGGGGGCCGGG + Intergenic
1185313821 22:50170427-50170449 CGCCGCCGCCCCCGGGGTCAGGG - Intergenic
1203254949 22_KI270733v1_random:133418-133440 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203263005 22_KI270733v1_random:178497-178519 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
949260514 3:2098902-2098924 CGCCGCCGCCCCGGGCCCCTCGG + Intronic
950316395 3:12004941-12004963 CGCCGCCGCCCTCGGGGGTCGGG + Intronic
950438491 3:12994153-12994175 CGCCCCCGCCCCCCCGCGCCCGG - Intronic
952167027 3:30761408-30761430 CGCCACCGACACTGGGTGCCTGG - Intronic
952942678 3:38455475-38455497 CGGCCCCGCCCCTGCACGCCCGG - Intronic
953027364 3:39152958-39152980 CCCCGCCGGCCGGGGGCGCCCGG + Intronic
955656612 3:61251198-61251220 CGCCGGCCCCACTGGGCTCCGGG + Intronic
956978972 3:74614603-74614625 CGCCGCCGCCGCCAAGCGCCAGG + Intergenic
959085647 3:101849152-101849174 CCCCGCCGGGCCTGGGCGCCCGG - Intronic
959530830 3:107431860-107431882 AGCCGCCAGCCCTGGGCTCCCGG + Intergenic
959539829 3:107525126-107525148 CCCCGGCGCCCCTGGGCCGCTGG - Intronic
961161480 3:124730419-124730441 CGCCGGAGGCCCGGGGCGCCTGG + Exonic
961202401 3:125055578-125055600 CGCTCCCGCCTCTGGGGGCCCGG + Exonic
961688308 3:128650617-128650639 AGCCGCCGCCCAGGTGCGCCAGG + Exonic
961735936 3:129002175-129002197 CGCCGCCCGCCCTGCGCGCCTGG + Exonic
962301848 3:134250495-134250517 CGCCCCCGCCCCGCGGCCCCCGG - Exonic
963503913 3:146161272-146161294 ACCCGCCGCCGCTGCGCGCCCGG + Intronic
963808647 3:149752510-149752532 CGCCGGAGCCTCTAGGCGCCGGG - Intergenic
964570789 3:158105835-158105857 CGCCGCCTCCGCCGGCCGCCCGG + Exonic
965590622 3:170357583-170357605 CGCCGCCGTCTCCGGCCGCCCGG - Intergenic
966355110 3:179071650-179071672 CGACGCCCGCCCTGCGCGCCCGG + Exonic
966866119 3:184260040-184260062 AGCCCCCGCCCGCGGGCGCCTGG + Exonic
967930434 3:194686791-194686813 CGCCGCCGCCCAGCTGCGCCGGG + Exonic
968514415 4:1010271-1010293 CGCAGCCGCCGCTGTGCACCCGG - Intronic
968729262 4:2261995-2262017 CGCCGCCGTCCCGGGGCGGACGG - Exonic
968729279 4:2262051-2262073 CGCCGCCCACCCCGCGCGCCCGG + Exonic
969360232 4:6658688-6658710 CGCCGCCCACGCGGGGCGCCGGG - Intergenic
969609277 4:8218000-8218022 CACCGCCACCCCTGTGGGCCTGG - Intronic
969715870 4:8867842-8867864 CGCAGCCGCCGCTGGGCCCCCGG - Exonic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
971757558 4:30721971-30721993 TGCCGCCGCCTCCGGGCTCCTGG - Exonic
980130301 4:128811408-128811430 CCCCGCCGCCCTCGGCCGCCAGG - Intronic
981128585 4:141133264-141133286 GGCCGCCGCCACTGAGCGCTGGG + Intronic
981300802 4:143184706-143184728 CGTCGCCGCACCTGCGCGGCGGG + Intergenic
983077511 4:163343962-163343984 CGCTGCAGGCCCTGGGCTCCCGG - Intronic
983940222 4:173529393-173529415 CCCCCCAGCCCCCGGGCGCCCGG + Exonic
984462989 4:180059155-180059177 CGCCGCCGCGGCCGGGCGCAGGG - Intergenic
985445156 4:190017641-190017663 CACCGCCACCCCTGGGCCGCGGG - Intergenic
985565333 5:612497-612519 CGCCGCCGCCCCGGGAAGCTCGG - Intronic
985748768 5:1662456-1662478 CCCAGCCGCCCCTCTGCGCCGGG + Intergenic
985996677 5:3600806-3600828 CCCCGCCAGCCCTGGGCGCCGGG + Intronic
986330815 5:6714632-6714654 GGCCGCGGCGCCTGGGCCCCGGG - Exonic
989379267 5:40797895-40797917 CGCCGCAGCCCCGCGGCGGCTGG + Intronic
989480495 5:41925347-41925369 CGCCGCCGCCCTTCAGCGACTGG + Exonic
989576454 5:42992654-42992676 CGCCGCCGCCCGGGAACGCCAGG - Intergenic
991351243 5:65722290-65722312 GGCGGCAGCGCCTGGGCGCCCGG - Exonic
991587355 5:68215086-68215108 CACCGCCGCCTCCGGGAGCCAGG - Intergenic
991711817 5:69415559-69415581 CGCGCCAGCCTCTGGGCGCCCGG - Intronic
992269704 5:75052737-75052759 AGCCCCCGCCCCTGGGCTTCGGG - Intergenic
992473136 5:77077329-77077351 CGCCGCGGCCCAGGCGCGCCGGG - Exonic
992530216 5:77645658-77645680 CGCTGCGCCCCCTGGGGGCCGGG - Intergenic
992627632 5:78649066-78649088 CGCCGCCGCCGCTGCCCGGCGGG - Intronic
992663656 5:78985129-78985151 CGCCGCCGGGCTCGGGCGCCGGG - Exonic
995052738 5:107724771-107724793 GGCCGCCGCCGCCGGGGGCCGGG - Intergenic
995804764 5:116038962-116038984 CTCCGCCACCCCTGGGCCCCAGG - Intronic
996308561 5:122077860-122077882 CGCCGGCGGCTCCGGGCGCCTGG - Exonic
997454073 5:134004785-134004807 CGCCTCCCCTCCTGCGCGCCCGG + Intronic
997568084 5:134904914-134904936 CGCCAGCGCCCTTGGCCGCCAGG - Intronic
997583985 5:135034051-135034073 TGCCGCCGCCTCTGCCCGCCCGG - Exonic
997975422 5:138439131-138439153 CGCCGCCGCCGCTCGGCCTCAGG + Exonic
998374785 5:141683035-141683057 TGCCTCCGCCCCTGGGAGACAGG - Intergenic
999062886 5:148654380-148654402 TGCCGCCCCCACTGGGCGCCAGG + Intronic
1000220521 5:159209541-159209563 CGCGGCCGCCGCAGAGCGCCGGG - Intronic
1001277484 5:170361137-170361159 CGCCGCCTCACCTGAGCACCTGG - Intronic
1001826736 5:174751388-174751410 GGCCGCCGCCTCCGTGCGCCTGG - Intergenic
1002176605 5:177404453-177404475 CCCCTCCGCCCCAGGGCTCCGGG - Intronic
1002186119 5:177455593-177455615 CGCCGCCGCCCGTGTTCTCCCGG - Intronic
1002424523 5:179167342-179167364 CGCGGCCGCACCCGGGCTCCCGG + Intronic
1002455898 5:179345215-179345237 CGCCGCCGCCCGCGAACGCCAGG - Exonic
1002479460 5:179490403-179490425 CGCCGCTGCTCCTGCCCGCCTGG - Intergenic
1002524170 5:179806437-179806459 CGCCGACGCCCAGGTGCGCCAGG + Intronic
1002541159 5:179907515-179907537 CGCCCCGGCCCCTCCGCGCCCGG + Intronic
1002635091 5:180603325-180603347 CGCCGCCTCCCTTGGGAGTCAGG + Exonic
1003049356 6:2765821-2765843 AGCCGCCGCCTCTTGGCGCCGGG - Exonic
1004262070 6:14117541-14117563 CGTCCCCGCCCCCGCGCGCCCGG - Intronic
1004396339 6:15248819-15248841 CCCCGCCGCCCCGCCGCGCCTGG - Intronic
1005320199 6:24646054-24646076 CGCCGCCGCCGCTCTGCGCGGGG + Exonic
1006083527 6:31580993-31581015 CCCCGCCGCCAGGGGGCGCCCGG + Exonic
1006137144 6:31902038-31902060 CGCCGCCGCCGCCGCGCGCGCGG - Intronic
1006180160 6:32149651-32149673 CCCCGCCGCCCCAGGGCCCAGGG - Exonic
1006406319 6:33847752-33847774 CCCAGCCTCCCCTGGGTGCCTGG - Intergenic
1006599033 6:35213753-35213775 GGCCGCTCCCCCTGCGCGCCCGG - Intergenic
1007584261 6:42979055-42979077 CGCCGCCGGCCACGGGCCCCCGG + Exonic
1007788915 6:44297791-44297813 TGCCGCTGCCGCTGCGCGCCAGG + Intronic
1013369100 6:109455049-109455071 CGCCCCGCCCCCTGTGCGCCCGG + Intronic
1013459019 6:110358011-110358033 CGCCGCCCCCCGGCGGCGCCCGG + Exonic
1014724918 6:124962471-124962493 CCCCGCTGCCCGCGGGCGCCGGG + Intergenic
1018400423 6:163414950-163414972 CGCCGCCGCTCTCGGCCGCCCGG - Exonic
1018945574 6:168345478-168345500 CGCCGCCTCCCCTGGGGGTGGGG + Intergenic
1019536129 7:1530785-1530807 CGCCGCCGCCGCCTGGCGCTCGG - Exonic
1019547579 7:1585893-1585915 CGCCGCCACCCCAGGGCTGCCGG - Intergenic
1019551027 7:1602606-1602628 CGGCCCCGCACCTGGGCTCCGGG + Intergenic
1019562585 7:1665936-1665958 CGCCGGCTCCGCTGGGCTCCGGG + Intergenic
1020111945 7:5452326-5452348 CCCAGCCGCTCCTGGGGGCCTGG + Intronic
1021890330 7:25180462-25180484 CGCCGCCGCTAGAGGGCGCCTGG - Intergenic
1023773693 7:43583344-43583366 CGCCGCCGCCCCAGGCCCGCGGG + Exonic
1023810349 7:43906619-43906641 CGCGGCCGCGGCTCGGCGCCGGG + Exonic
1024043833 7:45574484-45574506 CCTCGCCGGCCCGGGGCGCCGGG - Intronic
1024579946 7:50793331-50793353 CGCCGGCGGCGCGGGGCGCCCGG - Intronic
1025089646 7:56051701-56051723 CGCCGCCGCCATTGGGCCACAGG - Exonic
1026458925 7:70596315-70596337 GTCCGCCGCCTCTGGACGCCCGG - Intronic
1026665310 7:72336317-72336339 CGCCCCCGCCCGCAGGCGCCCGG - Intronic
1026732753 7:72925568-72925590 CGCCGCCGCTCCGGAGGGCCAGG + Intronic
1026909470 7:74083900-74083922 CGCCGCCGGCCCGGGGAGGCGGG - Intronic
1029667845 7:102007442-102007464 ACCCTCCGCCCCTGGGTGCCAGG + Intronic
1031997211 7:128240806-128240828 CCCCGACGGCCCTGGACGCCAGG - Intergenic
1032849532 7:135782330-135782352 AGCCTCCGCGCCTGGGCCCCAGG + Intergenic
1034100442 7:148445812-148445834 CGCCGCCACCCGTGGGAGCGTGG - Intergenic
1034284317 7:149874229-149874251 AGCCGCCGCCCCGGGGCGGAGGG - Intronic
1034306284 7:150047674-150047696 CGCCGCCGCCGCCGCGCTCCCGG + Intergenic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1034800563 7:154052979-154053001 CGCCGCCGCCGCCGCGCTCCCGG - Intronic
1034951322 7:155298456-155298478 CACTGCGGCCCCTGGGCGCGGGG - Exonic
1035153301 7:156892852-156892874 CGTCCCCGCCCCCGGGCCCCCGG - Intronic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1036733238 8:11284570-11284592 CGCCGCTGCCGTTGGGCTCCGGG - Exonic
1036794949 8:11749100-11749122 CGCAGCCTCCTCTGGGCACCTGG + Intronic
1037481905 8:19313581-19313603 CGCGGCCCCACCCGGGCGCCTGG - Intergenic
1037788889 8:21919659-21919681 CGCCGCTGCGCCTGCGCGCTGGG - Exonic
1037876462 8:22551304-22551326 CCCCGCCGCCCCTCCGCGCTGGG - Intronic
1037947736 8:22999728-22999750 GGCCGCCGCCGCTACGCGCCCGG - Intronic
1038311684 8:26449965-26449987 CCGCCCCGCCCCTGGGCGCCGGG - Intronic
1039554335 8:38466224-38466246 CGCCCCCGGCCCTGCGCACCGGG + Intronic
1039915716 8:41858969-41858991 GGGCGCCGCCCCTCTGCGCCTGG - Intronic
1040850786 8:51898903-51898925 CGCCGCCGCCAGTGGGGGCTCGG - Intronic
1041712941 8:60910068-60910090 GGCCGCGGGCCCTGCGCGCCCGG + Intergenic
1042532869 8:69833008-69833030 CGCCGCCGCCGCTGGGCCCGCGG + Exonic
1042785098 8:72537388-72537410 CGCCGCCGCCGCTGCGCCTCGGG + Exonic
1043471327 8:80566035-80566057 CGCGCCCGCCCCCGCGCGCCTGG - Intergenic
1043502807 8:80873844-80873866 CGCCGCCGCCGCGCAGCGCCGGG - Intronic
1043847295 8:85177533-85177555 CGCCGCAGCTCGGGGGCGCCGGG + Exonic
1044719757 8:95134008-95134030 CGCCGCCGCCCGCGGCCGTCGGG + Exonic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1044999811 8:97869422-97869444 CGCCGGGGCCCCGGGGCGCTGGG - Intronic
1045564365 8:103298796-103298818 CGCCGCCGCCGCCGCGAGCCCGG + Intronic
1049212206 8:141392008-141392030 CGCGGCCGCGCCTGTGCGCGAGG + Intronic
1049668387 8:143858949-143858971 CGCCGCCGCCGCCCGCCGCCAGG - Exonic
1049669633 8:143863752-143863774 CGCCGCCGCCGCCCGCCGCCAGG - Exonic
1049670043 8:143865345-143865367 CGCCGCCGCCGCCCGCCGCCAGG - Exonic
1049762195 8:144336647-144336669 CGCCGCCGCCCCCGGGGGCATGG - Intergenic
1049788577 8:144462775-144462797 CGCCGCCGCCTCAGTGGGCCCGG + Intronic
1049988128 9:970876-970898 CGCCGCCGCCCCGGGGCCCTTGG + Intergenic
1053240045 9:36487745-36487767 CGCGGCCGCCAATGGGCGCGGGG + Intergenic
1057488626 9:95506080-95506102 CGCCGCTGCCGCTGTCCGCCTGG - Intronic
1057665233 9:97039340-97039362 CCGCGCAGCCCCCGGGCGCCCGG - Intronic
1057801245 9:98192637-98192659 CGGCGGCGGCTCTGGGCGCCGGG - Intronic
1059414732 9:114155801-114155823 CTCGGGCGCCCCTGGGCGCGGGG + Exonic
1059414796 9:114155976-114155998 CGCCGCCGCCGCTGTGCCTCGGG - Exonic
1060629546 9:125143374-125143396 AGCCCCCGCACCTGGGGGCCAGG + Exonic
1060935812 9:127515233-127515255 AGCCACCGCGCCTGGCCGCCCGG - Intronic
1061015869 9:127980632-127980654 CGCCCCCGCACCTGGGTGCCGGG + Intergenic
1061208517 9:129177638-129177660 CCGCGCAGCCCCTGGGCGCCGGG + Exonic
1061449168 9:130659475-130659497 CTCCTCCGCCCCTGGGCGCCTGG + Intergenic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061786384 9:133030998-133031020 CGCCGCCATCCCTGTGCGTCTGG - Exonic
1061802763 9:133121185-133121207 CGCCGCCCCCGCCGCGCGCCGGG - Intronic
1061975853 9:134067797-134067819 CGGCGGCGGCCCCGGGCGCCCGG + Intronic
1062022764 9:134326955-134326977 CGCGGCTGCAGCTGGGCGCCGGG - Intronic
1062076352 9:134592083-134592105 CGCCACCGCCTCTGGGTGCAGGG - Intergenic
1062547550 9:137070448-137070470 CGGCCCCGGCCATGGGCGCCCGG + Exonic
1062555763 9:137112805-137112827 CGCCGCTGCCCCTGCACTCCAGG - Exonic
1062562018 9:137145911-137145933 CGGCGCCGCGGGTGGGCGCCTGG + Intronic
1062611093 9:137373776-137373798 GACCACCGCCCCTGGGGGCCTGG - Intronic
1062656358 9:137606031-137606053 CCCCGCCGCCCCTCGGCGAGAGG - Intronic
1203471351 Un_GL000220v1:116564-116586 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203479172 Un_GL000220v1:160536-160558 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1185647014 X:1623180-1623202 CGCCGAGGCCCCAGGGCCCCTGG + Exonic
1186426010 X:9464947-9464969 CGGCCCCGCCCCTGCGCCCCGGG - Intronic
1186426134 X:9465317-9465339 CGCGGCTGCTCCGGGGCGCCGGG + Exonic
1186496424 X:10015484-10015506 CGCGGCCGCCCCCGCGCCCCGGG + Intergenic
1187915727 X:24150365-24150387 CGCCGCCGCGCCGGGCCTCCGGG - Intronic
1189002061 X:36957880-36957902 CGCTGCCGCCCGAGGACGCCAGG - Intergenic
1189446430 X:41085408-41085430 CGCCGCCGCCACTGGCCGAGCGG + Intergenic
1190243572 X:48676445-48676467 CGCCTCCGTCCCTGCGCGCCGGG - Intergenic
1190285303 X:48957468-48957490 CTCCGCCGCGCCGCGGCGCCGGG + Exonic
1190308599 X:49101213-49101235 CGCCTCCGCCCCTGCGCTCCGGG - Intergenic
1195060740 X:101191608-101191630 CTCCACCACCACTGGGCGCCCGG + Intergenic
1195571437 X:106402085-106402107 TGCCGCCGCTCCTGGGCTCTAGG - Intergenic
1199793819 X:151177424-151177446 CGCCGCGGCCCTGGGGCTCCAGG + Intronic
1199793951 X:151177868-151177890 CGCCGCCGGCCCCCGGCCCCCGG - Intronic
1200078125 X:153561943-153561965 CCCCAGCGCCCCTGGGTGCCAGG - Intronic
1200100758 X:153688306-153688328 CGCCGCCGCCCGCGCGCCCCCGG + Exonic
1201162070 Y:11173773-11173795 GGCCTCCGCTCCTGCGCGCCAGG - Intergenic