ID: 909353461

View in Genome Browser
Species Human (GRCh38)
Location 1:74680308-74680330
Sequence TTAGGTTATAAGTAGATTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909353459_909353461 22 Left 909353459 1:74680263-74680285 CCTTTGAATTAAATTGTATAGAC No data
Right 909353461 1:74680308-74680330 TTAGGTTATAAGTAGATTCATGG No data
909353458_909353461 28 Left 909353458 1:74680257-74680279 CCACAACCTTTGAATTAAATTGT No data
Right 909353461 1:74680308-74680330 TTAGGTTATAAGTAGATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909353461 Original CRISPR TTAGGTTATAAGTAGATTCA TGG Intergenic
No off target data available for this crispr