ID: 909353598

View in Genome Browser
Species Human (GRCh38)
Location 1:74681937-74681959
Sequence TCTGGAATGTTGCTGGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909353598_909353603 14 Left 909353598 1:74681937-74681959 CCAGTAACCAGCAACATTCCAGA No data
Right 909353603 1:74681974-74681996 TCAGCCTATCCTCCTCACTGAGG No data
909353598_909353606 23 Left 909353598 1:74681937-74681959 CCAGTAACCAGCAACATTCCAGA No data
Right 909353606 1:74681983-74682005 CCTCCTCACTGAGGATGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909353598 Original CRISPR TCTGGAATGTTGCTGGTTAC TGG (reversed) Intergenic
No off target data available for this crispr