ID: 909355479

View in Genome Browser
Species Human (GRCh38)
Location 1:74703945-74703967
Sequence GAGGCCCACCTGCATTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 891
Summary {0: 1, 1: 4, 2: 32, 3: 197, 4: 657}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909355479_909355482 15 Left 909355479 1:74703945-74703967 CCTCAATAATGCAGGTGGGCCTC 0: 1
1: 4
2: 32
3: 197
4: 657
Right 909355482 1:74703983-74704005 AGCCTTAAGAACAAAAACTAAGG 0: 1
1: 0
2: 14
3: 82
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909355479 Original CRISPR GAGGCCCACCTGCATTATTG AGG (reversed) Intergenic
900330265 1:2130696-2130718 GAGGCCCACCTGCATTGTGGTGG + Intronic
900769782 1:4531480-4531502 GAGGCCCAACCACATTATGGGGG - Intergenic
900831308 1:4967632-4967654 GAAGCCCACCTGCATCATGAAGG - Intergenic
901027129 1:6284693-6284715 GAGGCCCCCCTGCAGCATCGAGG + Intronic
901223541 1:7597757-7597779 GAGGCCCACTGACATTATGGAGG + Intronic
901265286 1:7905568-7905590 GAGGCCTACCTGCACTGTGGAGG - Intergenic
901295906 1:8160741-8160763 GAGGCCCACCCACATTATTGAGG + Intergenic
901777935 1:11573482-11573504 GAGGCCCACCCACATTGTGGAGG + Intergenic
901784155 1:11613539-11613561 GAGGCCCACCCACATTATGGCGG + Intergenic
903386215 1:22928704-22928726 GAGGCCCACCCAAATTACTGAGG + Intergenic
903662443 1:24986538-24986560 GAGGCCCACCCACATTATGGAGG - Intergenic
904460066 1:30671302-30671324 GAGGCCCACCCACATTATGGAGG - Intergenic
904864078 1:33562743-33562765 GAGGCCCACCCACATTATGGAGG - Intronic
904936406 1:34132622-34132644 GAGGCCCACCCACATTGGTGAGG - Intronic
905531174 1:38679971-38679993 GAGGCCCACCTGGATAATTCGGG - Intergenic
905664466 1:39754505-39754527 GAGGCCTACCCACATTATGGAGG + Intronic
906354515 1:45092745-45092767 GAGGCCCACCCACATAATTGAGG - Intronic
906693396 1:47808096-47808118 GAAGCCCACCTACGTTATGGAGG - Intronic
906780219 1:48566665-48566687 GAGGCCCACCCACATTATGGAGG - Intronic
907061131 1:51426609-51426631 GTGGTCTACCTACATTATTGAGG - Intronic
907485206 1:54773164-54773186 GAGGCCCACCCACATTAGGGAGG + Intergenic
907549286 1:55290665-55290687 GAGGTCCACCCACATTATTGAGG + Intergenic
907577299 1:55538675-55538697 GAGGCCCATCTGCATTAGGAAGG - Intergenic
908015391 1:59827249-59827271 GAGACCCACCCACATTATGGAGG + Intronic
908096797 1:60747729-60747751 AAGGCCCACCTGGATCATTAAGG + Intergenic
908199459 1:61779439-61779461 GAGGCTCACCTACATCATTGAGG + Intronic
908423105 1:63979059-63979081 GAGGACCACCCACATTATGGAGG + Intronic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
909170665 1:72289849-72289871 GAGCCCCACCCACATTATGGAGG + Intergenic
909308804 1:74118931-74118953 GAGGCTCACCCACATTATGGAGG + Intronic
909355479 1:74703945-74703967 GAGGCCCACCTGCATTATTGAGG - Intergenic
909356520 1:74715973-74715995 GAGGCCCACCCACATTCTAGAGG - Intronic
909419245 1:75445110-75445132 TAGGCCCACCTCTAATATTGAGG - Intronic
909696120 1:78469757-78469779 GAGGGCCACCCACATTATGGAGG + Intronic
909728592 1:78866630-78866652 GAGTCCCATCTACATCATTGAGG - Intergenic
909986391 1:82165479-82165501 GAGGCTCACCTACATTATGGAGG - Intergenic
909992412 1:82239705-82239727 GAGGGACAGCTGCAGTATTGTGG - Intergenic
910076824 1:83290543-83290565 TAGGCCCACCTCCAATACTGGGG - Intergenic
910189685 1:84582985-84583007 GAGGCCCAGCTTCACCATTGCGG - Intergenic
910203800 1:84726884-84726906 GAGGCCCACCCACATTATGGAGG + Intergenic
910295058 1:85636256-85636278 AAGCCCCACCTCCATCATTGGGG - Intergenic
910633281 1:89379328-89379350 TAGGCCCACCTCCAACATTGGGG + Intronic
910896093 1:92071046-92071068 GAGGCCTACCTACATTATGAAGG - Intergenic
911175766 1:94816376-94816398 GAGGCCCACATACATTAGAGAGG + Intergenic
911306571 1:96239519-96239541 GAAGCCCACCTACGTTATGGAGG - Intergenic
911378105 1:97076442-97076464 GAGGCCCACCCACATTATGAAGG + Intergenic
911417811 1:97597624-97597646 AGGGCCCACCCACATTATTGAGG - Intronic
911500110 1:98675080-98675102 GAGACACACATCCATTATTGTGG + Intronic
912717804 1:111994302-111994324 TAGGCCCACCTCCAACATTGGGG - Intergenic
912968488 1:114258270-114258292 GAGGCCCACCCACATTAGGGAGG + Intergenic
913519766 1:119633574-119633596 GAGGCCCACCCACATTATGGTGG + Intronic
913955880 1:143292496-143292518 GAGCCCCACCTGCAACATTGAGG - Intergenic
913981553 1:143522941-143522963 GAGCCCCACCTGCAACATTGGGG + Intergenic
914075925 1:144349600-144349622 GAGCCCCACCTGCAACATTGGGG + Intergenic
914103253 1:144616896-144616918 GAGCCCCACCTGCAACATTGGGG - Intergenic
914394061 1:147247955-147247977 CAGGCCCACCTGGATAATTCAGG + Intronic
914982616 1:152428276-152428298 GAGGCCCACCCACATTACAGAGG + Intergenic
915481641 1:156190309-156190331 GAGACCCACCCACATTATTGAGG + Intergenic
916847557 1:168668680-168668702 GAGACCCACCTGGATTATCAAGG - Intergenic
917716866 1:177747239-177747261 GAGGCCCACCAACATTAAGGAGG - Intergenic
917942947 1:179941479-179941501 GAGCCCCACCCACATTATGGAGG - Intergenic
918698322 1:187574313-187574335 GAGGCTCACTTACATTATAGAGG - Intergenic
918741685 1:188139990-188140012 GAGGCCTACCCACATTATGGGGG - Intergenic
919350918 1:196452870-196452892 GAGGTCCACCCACATTATGGAGG + Intronic
919656455 1:200201611-200201633 GAGTCCCACCCACATGATTGAGG - Intergenic
920552992 1:206880431-206880453 GAGGCCCACCTACATTGGGGAGG + Intergenic
920669527 1:207992472-207992494 GAGGCCCACCCACATTATGGAGG - Intergenic
920820137 1:209372746-209372768 GAGGCCCACCCACATTACGGAGG + Intergenic
920882424 1:209893003-209893025 GAGACCCACCCACATTATGGAGG - Intergenic
920927014 1:210351294-210351316 GGTGCCCACCTGCATTAAAGAGG + Intronic
920930184 1:210380780-210380802 GAGGCCCAGCTGCATGAATGTGG + Intronic
920942105 1:210493450-210493472 AAGGCCCACCCACATTATGGAGG + Intronic
921123243 1:212154815-212154837 AAGGACCACCTGCATGATGGAGG - Intergenic
921662091 1:217815677-217815699 GAGACCCACCCACATTATGGAGG - Intronic
921730235 1:218569902-218569924 GAGGCCAACCCTCATTATAGAGG - Intergenic
921853878 1:219959953-219959975 GAGGCCCACCCACATTAGTGAGG - Intergenic
922026219 1:221751645-221751667 GAGGCCCACCCAAATTATGGGGG - Intergenic
922064769 1:222126052-222126074 AGGGCCCACCTGCATAATTCAGG + Intergenic
922890815 1:229060775-229060797 GAGGCCCACCCGTGTTATGGAGG + Intergenic
922975840 1:229782669-229782691 GAGGCCCACCCACATTATGGAGG + Intergenic
923134373 1:231105126-231105148 GAGGCCCACCTGTATTGTGGAGG + Intergenic
923491699 1:234489852-234489874 GAGGCCCACCCACACTATGGGGG - Intergenic
923498049 1:234541923-234541945 GAGGCCCACCTGCAACATGGAGG - Intergenic
923504058 1:234590530-234590552 GAGGTCCATCTACATTATGGAGG - Intergenic
923885894 1:238155287-238155309 GAGGCCCATCTACATTATGAAGG + Intergenic
924123048 1:240822120-240822142 GAGGCCCACCCGCATTGTGAAGG - Intronic
1063027351 10:2193533-2193555 GAGGCCCACCTGCATCAGGGAGG + Intergenic
1063217334 10:3936673-3936695 CAGGCCCACCTCCAGCATTGGGG - Intergenic
1063246546 10:4225648-4225670 GAGGCCCACCCACGTTATAGAGG - Intergenic
1063356694 10:5407204-5407226 GAGGCCCACTCACATTATTGAGG - Intergenic
1063558862 10:7107736-7107758 GAGGCCCATCTACATTATGAGGG - Intergenic
1063624856 10:7679466-7679488 GAGGCCCACCCACATTATGAAGG + Intergenic
1063679211 10:8171205-8171227 GAGGCCCACCCACATTAGGGAGG + Intergenic
1064129184 10:12693026-12693048 TAGGCCCACCCACATTATAGAGG - Intronic
1064254969 10:13735720-13735742 AAGGCCGACATGCATAATTGAGG - Intronic
1064380020 10:14833277-14833299 AAGGCCCACCCACATTATGGAGG - Intronic
1064446228 10:15396178-15396200 GAGGTCCACCCACATTATGGAGG + Intergenic
1064864682 10:19866486-19866508 TAGGCCCACATGGATAATTGAGG + Intronic
1065255670 10:23864944-23864966 GAGGCCCACCCACATTATGAAGG + Intronic
1065905733 10:30249429-30249451 GAGGCCCACCCACATCATGGAGG - Intergenic
1066063184 10:31742429-31742451 GAGGCCCACCCACATTATAGAGG - Intergenic
1066076819 10:31887280-31887302 GAGGCCCACCCACATTACAGAGG + Intronic
1066676203 10:37890015-37890037 CAGGCCCACCTCCAGCATTGGGG + Intergenic
1066952599 10:42135913-42135935 AAGCCCCACCTGCAATATTGGGG - Intergenic
1067179147 10:43971895-43971917 CAGGCCCACCTGCAACACTGGGG + Intergenic
1067216304 10:44307041-44307063 GAGGCCCACCTCCAACACTGGGG + Intergenic
1067248552 10:44567202-44567224 GAGGCCCACCCACATTAGGGAGG - Intergenic
1067565975 10:47337439-47337461 GAGACCCACCCACATTATGGCGG - Intergenic
1068286782 10:54948371-54948393 GAGGCCCACCCACATTAGAGAGG + Intronic
1069286069 10:66716973-66716995 GAAGCCCACCTACATTATCAAGG - Intronic
1070000048 10:72369495-72369517 GCGGCACACCTGGAATATTGGGG + Intronic
1070706616 10:78643708-78643730 AAGGCCCACCCACATTATGGAGG + Intergenic
1071104270 10:82076520-82076542 TAGGCCCACCTCCAACATTGGGG - Intronic
1071305439 10:84295261-84295283 GAGGCCCACCCACATCATGGAGG + Intergenic
1071343483 10:84669069-84669091 GAAGCCCAGCTGCACTAATGGGG - Intergenic
1071387363 10:85135080-85135102 AAGACCCACCTGCATTATAGAGG - Intergenic
1071468037 10:85958609-85958631 GAAGCCCACCTACATTAGTGGGG - Intronic
1071967391 10:90866223-90866245 GAGGCCCACCCACATTAGGGAGG - Intergenic
1072035459 10:91559157-91559179 GAGGCCCACCCACATTAGGGAGG - Intergenic
1072237259 10:93464093-93464115 GAGGCCCATCTAAATTATAGAGG - Intronic
1073840892 10:107497569-107497591 GAGGCCCAGCCACATTATGGAGG - Intergenic
1073982327 10:109168813-109168835 GAGGCCCACACACATTATGGAGG - Intergenic
1074020450 10:109577173-109577195 GAGGCCCACATATATTATTGAGG - Intergenic
1074060241 10:109958820-109958842 GAGGCTCGCCTGCATTACGGAGG + Intergenic
1074831986 10:117255644-117255666 GAGCCCCACCTGCAGCAATGAGG - Exonic
1075047002 10:119154207-119154229 GAGGCCCACCCACATTGTGGAGG - Intronic
1075134015 10:119766222-119766244 GATGCCCACCTGTATTGGTGAGG + Intronic
1075342705 10:121660317-121660339 GAGGCCTACCCACATTATGGAGG + Intergenic
1075836765 10:125460506-125460528 GAGGCCCACCCACATTATGGAGG - Intergenic
1076425955 10:130367833-130367855 GAGGCCCTCCTGGATTAGGGTGG + Intergenic
1077726244 11:4677645-4677667 GAGGCCCACCCCCATTATGGAGG + Intergenic
1078024347 11:7680454-7680476 CAGGCCCACCCGGATAATTGAGG - Intergenic
1078231958 11:9451724-9451746 GAGACCAGCCTGGATTATTGGGG + Intergenic
1078817530 11:14841102-14841124 GAGGCCCACCGACCTTATGGAGG - Intronic
1079021707 11:16914529-16914551 GAGACCCCCATGAATTATTGAGG - Intronic
1079092339 11:17489822-17489844 GAGGCCCACCCACATGATGGAGG - Intergenic
1079383933 11:19962257-19962279 GAGACCCACCTACATTATGGAGG + Intronic
1079448657 11:20580260-20580282 GATGCCCACCTACATTGGTGAGG + Intergenic
1079552299 11:21715027-21715049 CAGGCCCACCTACAATATGGGGG - Intergenic
1079885511 11:25983480-25983502 GAGGCCCACCCACATTATGGAGG + Intergenic
1080086259 11:28286241-28286263 GAGGCACATCTACATTATTAAGG + Intronic
1080340024 11:31251417-31251439 GAGGCCCACCAACATTAGAGAGG - Intronic
1080413021 11:32044068-32044090 GATGCCCACATGTATGATTGTGG - Intronic
1080431635 11:32204965-32204987 GAGGCCCACCCACATGATGGAGG + Intergenic
1080595059 11:33765656-33765678 CAGGCCCCCCTCCAATATTGGGG - Intronic
1080722843 11:34866674-34866696 GAGGCCCACCCATATTATGGGGG + Intronic
1080798566 11:35588561-35588583 AAGGCCCACCCACATTATGGAGG - Intergenic
1082726661 11:56744819-56744841 GGGCCCCACCTGCATGTTTGGGG - Intergenic
1083037627 11:59654856-59654878 GAGCTCCACCCACATTATTGAGG - Intronic
1083336716 11:61926452-61926474 AAGGCCCACCTCCAACATTGGGG - Intergenic
1083791142 11:64986847-64986869 GAGGCCCACCTACATTATGGAGG - Intergenic
1083965273 11:66039942-66039964 TAGGCCCACCTCCAACATTGGGG - Intergenic
1084200752 11:67556418-67556440 GAGGCCCACCCCCATTATGGAGG + Intergenic
1086123707 11:83327935-83327957 GAGGCCCACTCCCATTATGGAGG - Intergenic
1087659237 11:100966545-100966567 GAGGCCCACCTACATTTTGGAGG + Intronic
1088032129 11:105264052-105264074 GAAGCCCACCCACATTAGTGAGG + Intergenic
1088785790 11:113180697-113180719 GAGGCCTCACTGCGTTATTGGGG + Intronic
1088828817 11:113517882-113517904 AAGGCCCACCTGCATTATGAAGG + Intergenic
1088968076 11:114745497-114745519 CAGGCCCACCTCCAATACTGGGG + Intergenic
1089164438 11:116464278-116464300 GAGGCCCACCCACATTGGTGAGG - Intergenic
1090098642 11:123770201-123770223 GATGCTCACCTGCATTTGTGAGG + Intergenic
1090494562 11:127197645-127197667 GAGGCCCACCTGCATTATGGAGG + Intergenic
1090752323 11:129758393-129758415 GAGGCCCACTTACATTATGGAGG - Intergenic
1090821552 11:130347014-130347036 AAGGCCCACCCACATTATCGGGG - Intergenic
1091186460 11:133652106-133652128 GAGGCAAACCTTCATAATTGAGG - Intergenic
1091248364 11:134119699-134119721 GAGGCCCGCCCTCATTATGGAGG + Intronic
1092314554 12:7396595-7396617 GAGGCCCACCCACGTTATGGAGG - Intronic
1092325501 12:7527470-7527492 GAGGAGCAGCTGCAGTATTGTGG - Intergenic
1092546298 12:9454508-9454530 GAGGTCCACCCACATTATGGAGG + Intergenic
1092697861 12:11193397-11193419 GAAACCCACCTACATTGTTGAGG - Intergenic
1092749974 12:11709717-11709739 GAGGCCTACCCGCATTACGGAGG - Intronic
1092750297 12:11712694-11712716 GAGGCCCACCCATATTATGGAGG + Intronic
1092923418 12:13252534-13252556 GAGGCCCACCCACATTAAGGAGG + Intergenic
1092937384 12:13376724-13376746 GAGGCCCACCCACATTGGTGAGG + Intronic
1093222081 12:16433592-16433614 GAGGCCCACCCACATTAGGGAGG + Intronic
1093253800 12:16840901-16840923 GAGGCCCACCCACATTACTGAGG - Intergenic
1093285660 12:17257723-17257745 GAGGGCCACCCACATTATGGAGG + Intergenic
1093502999 12:19833763-19833785 GAGGCCCACCTACATTATGGAGG - Intergenic
1093683085 12:22024919-22024941 GATGCCCACCCACATTAGTGAGG - Intergenic
1093758881 12:22882720-22882742 GAGGCCCACCCACATTATGAAGG - Intergenic
1094251522 12:28367845-28367867 GTTGCCCACCTACATTATGGAGG - Intronic
1095385458 12:41644853-41644875 GAGGCCCATCTGCTTTACTCAGG - Intergenic
1095728933 12:45483778-45483800 TAGGCCCACCTCCAGTACTGGGG + Intergenic
1095844723 12:46732404-46732426 GAGCAGCACCTGCATTTTTGAGG - Intergenic
1097753633 12:63385233-63385255 GAGGCCCACCCACATTATGGAGG + Intergenic
1098580736 12:72095902-72095924 GAGGCCCAACCACATTATAGAGG - Intronic
1100569317 12:95832102-95832124 GAGGCCCACCCACATTATGGAGG - Intergenic
1100811637 12:98344736-98344758 AATGCCCACCTGAATTAGTGAGG - Intergenic
1101222202 12:102653398-102653420 GAGGGCCACCCACATTAGTGAGG - Intergenic
1101319815 12:103663693-103663715 GAGGCCCTGCTGAATTAGTGTGG - Intronic
1101378157 12:104188719-104188741 GAGGCCCACTTACATTTTGGAGG + Intergenic
1101378418 12:104190996-104191018 GAGGCCCACCCACATTTTGGAGG + Intergenic
1101703340 12:107196083-107196105 GAAGCCCACCCACATTATGGAGG - Intergenic
1101711109 12:107267741-107267763 GAGCCTCACCTGCATTTGTGTGG + Intergenic
1102098321 12:110257943-110257965 GAGGCCCCCTTCCATTCTTGTGG + Intergenic
1102218883 12:111180814-111180836 GAGGCTCCCCTGAGTTATTGAGG + Intronic
1103453770 12:121048819-121048841 GGTGCCCACCTACATTAGTGAGG - Intergenic
1104502019 12:129295038-129295060 GAGGCCCACCCACATTATGGAGG - Intronic
1104507397 12:129345264-129345286 GAAGGCCAGCTGCATTAATGAGG - Intronic
1104600654 12:130151158-130151180 GAGGCCCGCCCACATTCTTGAGG + Intergenic
1104669385 12:130670017-130670039 GGGGCCCACCTGCATAATCCAGG - Intronic
1104713535 12:131002596-131002618 GAGGGCCCCCTGCTTTCTTGGGG + Intronic
1105232599 13:18512015-18512037 AAGCCCCACCTGCAACATTGGGG + Intergenic
1105542175 13:21325376-21325398 GAGGCCCACCCACATTATGAAGG - Intergenic
1105589135 13:21775110-21775132 GAAGCCCACCTACATTATTGAGG - Intergenic
1105764580 13:23546791-23546813 GAGGTCCACCTGCATGCTTTTGG + Intergenic
1106010252 13:25813828-25813850 GAGGCCCACCCACATTAGGGAGG - Intronic
1106160735 13:27199234-27199256 GGTGCCCACCTGCATTATTGAGG - Intergenic
1106356172 13:28985786-28985808 GAGGCCCACCCACATCATGGAGG - Intronic
1106734240 13:32572914-32572936 GAGGCTCACTTACATTATGGTGG - Intergenic
1107046319 13:35996501-35996523 GAGGCCCACCTGCATTACAGAGG - Intronic
1107148890 13:37089669-37089691 GAGGCCCGCCCACATTATGGAGG - Intergenic
1107152697 13:37130175-37130197 GAGGCCCACTCACATTATGGAGG + Intergenic
1107650324 13:42538433-42538455 GAGGACCACCCACATTATGGAGG - Intergenic
1107707417 13:43121697-43121719 AAGGCCCACCCACATTATGGCGG - Intergenic
1107786544 13:43963388-43963410 GAGGCCCACTCACATTATGGAGG + Intergenic
1107857024 13:44626353-44626375 GAGGCCCACCCACATTATTGAGG - Intergenic
1108731044 13:53236198-53236220 TAGGCCCACCTCCAACATTGGGG - Intergenic
1109009633 13:56923664-56923686 GAGGTCCACCCACATTATGGAGG - Intergenic
1109206416 13:59487684-59487706 TAGGCCCACCTCCAACATTGGGG + Intergenic
1110280009 13:73681997-73682019 GAGGCCCACCCACATTATGGGGG + Intergenic
1110888742 13:80671805-80671827 GAGGCCCACTTCCAATACTGGGG + Intergenic
1111066186 13:83095533-83095555 GAGGCCCACCCACATTAGGGAGG - Intergenic
1111447750 13:88371997-88372019 GAGGCCTACCTCCATTATTAAGG + Intergenic
1111535547 13:89598218-89598240 GAGGCCCAGCTGCATTGGTGAGG - Intergenic
1111707502 13:91769236-91769258 GAGGACCACCAACATTATGGAGG + Intronic
1111948130 13:94686952-94686974 GAGCCCCATCTGCATTATCAAGG - Intergenic
1112407106 13:99130804-99130826 GAGGCCCACCCAGATTATGGTGG + Intergenic
1112845362 13:103636135-103636157 GAGGCCCACATACATTAGGGAGG - Intergenic
1113310469 13:109127221-109127243 GAGGCCCAGATGCATTATTCCGG - Intronic
1113394842 13:109937789-109937811 GAGGCTCACCGACATTATGGAGG + Intergenic
1113402123 13:110003977-110003999 AAGGCCCACCCACATTTTTGAGG - Intergenic
1113426232 13:110210754-110210776 GAGGCCCACCAGCATTATGGAGG - Intronic
1113684751 13:112275218-112275240 GAGGCCCACCCCCATTAGGGAGG - Intergenic
1114204371 14:20554848-20554870 GATGCCCACCTGCATGGGTGAGG + Intergenic
1114339977 14:21733182-21733204 GATGCCCACCTGCATTGATTAGG + Intergenic
1115300682 14:31881835-31881857 GAGGCCCACCCACATCATGGGGG + Intergenic
1115310206 14:31971811-31971833 TAGGCCCACCCAAATTATTGAGG + Intergenic
1115667305 14:35565456-35565478 GAGGCCCACCCACATTATAGAGG - Intronic
1116213768 14:41982981-41983003 GAGGCCCACTTGTATTATAAAGG + Intergenic
1116430608 14:44841504-44841526 GATGCCCACCCACATTTTTGAGG - Intergenic
1116549392 14:46216211-46216233 GAGGCCCGCCTGTATTGGTGAGG + Intergenic
1116981391 14:51174682-51174704 GATGCCCACCTACATTGGTGGGG - Intergenic
1117090561 14:52245930-52245952 AGGCCCCACCTGCAATATTGGGG - Intergenic
1117292359 14:54345739-54345761 GAGGCCCACCCATATTATGGAGG - Intergenic
1117799798 14:59431490-59431512 CAGGCCCACCTGCATAATACAGG - Intronic
1118047012 14:61981180-61981202 GAGGCCCACCTACATTATGGAGG + Intergenic
1118474822 14:66106674-66106696 GAGGGCTACCTACATTATGGAGG + Intergenic
1118781616 14:69012383-69012405 GAGGCCCACCCACATCATGGAGG - Intergenic
1119064849 14:71514679-71514701 GAGGCCCACCCACATTGTGGAGG + Intronic
1119137061 14:72230772-72230794 GAGGCCCACCTGCATGATCAAGG + Intronic
1120016540 14:79480671-79480693 AAGGCCCACCTCCAATACTGGGG - Intronic
1120086366 14:80278712-80278734 GAGGCCCATCTGCATTATAGAGG + Intronic
1120168726 14:81227754-81227776 AAGGCCTACCTGCATTATTGAGG + Intergenic
1120644279 14:87054499-87054521 GAGGCCCACACGCATTTTGGAGG + Intergenic
1120715678 14:87838498-87838520 GAGGCCCACCCACATTAGGGAGG + Intronic
1120902399 14:89587214-89587236 GAGGCCCACCCACATTATGGGGG + Intronic
1120906206 14:89623467-89623489 GAGGCCCACCCACATTAGGGTGG + Intergenic
1122088960 14:99325565-99325587 GAGGCCCACCTGCATTGGGCAGG + Intergenic
1122567823 14:102674211-102674233 AAGGCCCACCCACATTATGGAGG + Intronic
1123100739 14:105797743-105797765 GAGGCCCACCCACATTTTGGAGG - Intergenic
1202938383 14_KI270725v1_random:116017-116039 AAGCCCCACCTGCAACATTGGGG - Intergenic
1123394812 15:19921871-19921893 AAGCCCCACCTGCAACATTGGGG + Intergenic
1123708537 15:22968343-22968365 GAGGCCCACCCAAATTATGGAGG - Intronic
1123978160 15:25572480-25572502 GAGGCCCACTCACATTATGGGGG + Intergenic
1124099489 15:26680098-26680120 GAGGCCCACCTTCATCGTGGAGG - Intronic
1124420328 15:29515421-29515443 GATGACCACCTGCATTGGTGAGG + Intronic
1124428193 15:29581402-29581424 GAGGGCCACCCACATTATGGAGG + Intergenic
1124509417 15:30310354-30310376 TAGGCCCACCTGGATTTTGGTGG - Intergenic
1124733614 15:32223477-32223499 GAGGCCCAACTACATTATGGAGG + Intergenic
1124734142 15:32228308-32228330 TAGGCCCACCTGGATTTTGGTGG + Intergenic
1124815132 15:32982638-32982660 GAGGCCCACCTACATTAGGGAGG - Intronic
1124924515 15:34058150-34058172 GAGGCCTACCCACATTATGGTGG + Intronic
1125037320 15:35140864-35140886 GAGGCCCTCTTACATTATAGAGG - Intergenic
1125091616 15:35799554-35799576 GAGGCCTACCAGCATTATCAAGG + Intergenic
1125257055 15:37777360-37777382 GAGGCCCACCTACGTTAGTGAGG + Intergenic
1125763881 15:42119933-42119955 GAGGCCGACCCACATTACTGAGG - Intergenic
1126034536 15:44534682-44534704 GCGGCCCACCCTCATTATAGAGG + Intergenic
1126068833 15:44847869-44847891 GAGGCTCACCCACATTATGGAGG - Intergenic
1126089994 15:45042928-45042950 GAGGCTCACCCACATTATGGAGG + Intronic
1126750389 15:51870970-51870992 GAGGCCCACCCACATTATGGAGG + Intronic
1127184199 15:56461140-56461162 GAGGCCCACCTATATTAGGGAGG + Intronic
1127536797 15:59897540-59897562 GAGGCCCACCCACATTATCTAGG - Intergenic
1128759267 15:70204394-70204416 GATGCCCACTTGCATTGGTGAGG - Intergenic
1128792404 15:70442840-70442862 GGGGCCCACCTGGATGACTGGGG - Intergenic
1128825989 15:70717838-70717860 GAGGCCTATCTACATTATAGAGG - Intronic
1129233019 15:74207145-74207167 GAGGCCCACGTGCATTTCTGCGG + Intronic
1130377238 15:83340245-83340267 GAGGCCCACCCATATTATGGAGG - Intergenic
1130682801 15:86011069-86011091 GTGGCCCACCCACATTATGGAGG - Intergenic
1131153041 15:90058918-90058940 GATGCCCACCCACATTATGGAGG + Intronic
1131487482 15:92833689-92833711 GAGGCCCACCCACAGTATGGAGG + Intergenic
1131943381 15:97592329-97592351 GAAGCCCACCCAGATTATTGTGG - Intergenic
1131997205 15:98144208-98144230 GAGGCCCACCCACATTGGTGAGG + Intergenic
1131998480 15:98156539-98156561 GAAGCTCACCTGCATTATGGAGG - Intergenic
1132138641 15:99369609-99369631 GAGGCCCACCCACACTATGGAGG + Intronic
1132194454 15:99901382-99901404 AGGCCCCACCTGCAATATTGGGG - Intergenic
1132306247 15:100815330-100815352 GAGGCCCACTCACATTATTGAGG + Intergenic
1132421911 15:101677254-101677276 GAGGCCCACCCACATTGGTGAGG - Intronic
1133066690 16:3212788-3212810 AAGGCCCACCCACATTATGGAGG + Intergenic
1133558083 16:6924510-6924532 CAGGCCCACCTCCAACATTGGGG + Intronic
1135886645 16:26316011-26316033 GAGGCCCACCCATATTATAGAGG - Intergenic
1136700908 16:32140287-32140309 GAGCCCCACCTGCAACATTGGGG + Intergenic
1136766749 16:32787171-32787193 GAGCCCCACCTGCAACATTGGGG - Intergenic
1136770446 16:32834859-32834881 GAGCCCCACCTGCAACATTGGGG - Intergenic
1136801348 16:33083207-33083229 GAGCCCCACCTGCAACACTGGGG + Intergenic
1136900156 16:34027127-34027149 AAGCCCCACCTGCAACATTGGGG + Intergenic
1136936566 16:34472749-34472771 AAGCCCCACCTGCAACATTGGGG - Intergenic
1136955494 16:34780213-34780235 AAGCCCCACCTGCAACATTGGGG + Intergenic
1136963253 16:34875821-34875843 AAGCCCCACCTGCAACATTGGGG + Intergenic
1136967342 16:34930026-34930048 AAGCCCCACCTGCAACATTGGGG + Intergenic
1137220807 16:46449267-46449289 AAGCCCCACCTGCAACATTGGGG - Intergenic
1137959533 16:52868376-52868398 GAGGCTCACCCAGATTATTGAGG + Intergenic
1138964525 16:62068176-62068198 GAGGCCCACCCACATTATGGAGG + Intergenic
1138996103 16:62454894-62454916 AAGACCCACCTCCATCATTGGGG - Intergenic
1139126431 16:64083596-64083618 AAGGCCCACCTACATTATAAAGG - Intergenic
1140374049 16:74430576-74430598 GAGGCCCACCCATATTATGGAGG + Intergenic
1203069142 16_KI270728v1_random:1049423-1049445 GAGCCCCACCTGCAACATTGGGG - Intergenic
1203072867 16_KI270728v1_random:1096965-1096987 GAGCCCCACCTGCAACATTGGGG - Intergenic
1143353217 17:6305080-6305102 AAGGCCCACCCACATTATGGAGG + Intergenic
1144188974 17:12825635-12825657 GAGGCCCACCCACATTATTGAGG + Intronic
1144309645 17:14000764-14000786 GGGCCCCACCTGCAACATTGGGG - Intergenic
1145691420 17:26744278-26744300 GAGCCCCACCTGCAACATTGGGG + Intergenic
1145735208 17:27224779-27224801 GAGGCCCATCCACATTATAGAGG + Intergenic
1146165788 17:30587336-30587358 GAGGCCCACCCACATTATGGAGG - Intergenic
1146546534 17:33743566-33743588 GAGGCTCACCTGTATTATGGAGG - Intronic
1148283667 17:46369320-46369342 GAGGCCCACCTACATTATGGAGG + Intergenic
1148305885 17:46587237-46587259 GAGGCCCACCTACATTATGGAGG + Intergenic
1149321232 17:55483483-55483505 GAGGCCCACCCACATGATGGAGG - Intergenic
1149981598 17:61315590-61315612 GAGGCACCCCAGCATCATTGGGG - Intronic
1150050266 17:61955209-61955231 AGGGCCCACCTGCGTAATTGAGG + Intronic
1150938140 17:69659849-69659871 TAGGCCCACTTGCAACATTGAGG + Intergenic
1150975302 17:70079326-70079348 AAGGCCCACCTACATTATGGAGG + Intronic
1203182947 17_KI270729v1_random:81819-81841 AAGCCCCACCTGCAACATTGGGG + Intergenic
1153326866 18:3829721-3829743 GAGGCCCATCCACATTATGGAGG + Intronic
1153438834 18:5094821-5094843 GAGGCCCAACCACATTATTAAGG - Intergenic
1153729882 18:8000092-8000114 AAGGCCCACCTGCATTAGGGAGG + Intronic
1154272888 18:12935119-12935141 GAGGCTCACTCTCATTATTGAGG + Intergenic
1154367371 18:13723599-13723621 GAGGTCCACCCACATTATTTAGG + Intronic
1154511014 18:15102208-15102230 GAGGCCCACCTACATTAACGAGG + Intergenic
1154520716 18:15226670-15226692 AAGCCCCACCTGCAACATTGGGG - Intergenic
1155059088 18:22212663-22212685 GAGGCCCACATACATGATGGAGG + Intergenic
1156025386 18:32647829-32647851 GAGGTCCACCCACATTATGGAGG + Intergenic
1156270603 18:35526972-35526994 TAGGCCCACCTCCAGCATTGGGG + Intergenic
1156312215 18:35935138-35935160 TAGGCCCACCTCCAACATTGGGG + Intergenic
1156576597 18:38324078-38324100 GAGGCCCACCCACATTATGAAGG - Intergenic
1156629523 18:38950023-38950045 AAGGCCCACCAGCATTGATGAGG + Intergenic
1157046725 18:44109087-44109109 GAGGCCCACCTACATTATGGAGG - Intergenic
1157415263 18:47497173-47497195 AAGGCCCATCTGCAATATGGAGG + Intergenic
1157999063 18:52594879-52594901 CAGGCCCACCTCCAACATTGAGG + Intronic
1158665386 18:59428073-59428095 GAGCCCCACCCACATTATGGAGG - Intergenic
1158671477 18:59478024-59478046 GAGGCCCACCCGCATTATGGAGG - Intronic
1158821499 18:61164699-61164721 GAGGCCCACCCACATTATGAAGG + Intergenic
1158982401 18:62776383-62776405 TAGGCCCACCCACATTATAGAGG + Intronic
1159555320 18:69939772-69939794 TAGGCTCACCTACATTATGGAGG - Intronic
1159807480 18:72973778-72973800 GAGCCCCACCCACATTATGGAGG + Intergenic
1159817561 18:73094685-73094707 GATGCCTACCTGCATTGGTGAGG - Intergenic
1160144632 18:76353507-76353529 TAGGCCCACCTCCAACATTGAGG - Intergenic
1161687595 19:5711086-5711108 CAGGCCCACCTGGGTTCTTGAGG - Intronic
1161825088 19:6558165-6558187 GAGGCCCACCCACATTATGGAGG + Intergenic
1162148559 19:8629040-8629062 GAGGTCCTCCTGCGTTATGGTGG - Intergenic
1162994387 19:14324772-14324794 GATGCCCACCTACATTAGGGAGG + Intergenic
1163410117 19:17148915-17148937 AGGGCCCTCCTGGATTATTGAGG + Intronic
1164683834 19:30153609-30153631 CAGAGCCACTTGCATTATTGAGG - Intergenic
1165012762 19:32860710-32860732 GAGGCCAACATTTATTATTGTGG - Intronic
1165188915 19:34045870-34045892 GAGGCCCACTCACATTATGGAGG - Intergenic
1165715133 19:38039722-38039744 GAGGCCCACCTGAAACATTCAGG + Intronic
1166651543 19:44578980-44579002 TAGGCCCACATCCATCATTGGGG - Intergenic
1167736678 19:51298696-51298718 CAGACCCACCTACATTATTGAGG + Intergenic
1202671066 1_KI270709v1_random:52368-52390 GAGCCCCACCTGCAACATTGGGG + Intergenic
925251779 2:2445079-2445101 GAGGCCCACCAGGATTACAGAGG + Intergenic
925328338 2:3039763-3039785 GCTGACCACCTGCATTATTTAGG - Intergenic
925688778 2:6498418-6498440 GAGGCCCATTTGCATTACGGAGG - Intergenic
926343366 2:11923239-11923261 GAGGTCCACCCACATTATAGAGG + Intergenic
926609043 2:14926996-14927018 GAGGCCCAGCTGTATTATGAAGG - Intergenic
926671545 2:15581508-15581530 GAGGCCTACCCACATTATGGAGG - Intergenic
926751671 2:16203181-16203203 GAGGTCCACCCACATTATGGAGG - Intergenic
926915305 2:17885694-17885716 GAAGCCCACCAGCATTATAGAGG + Intronic
927676726 2:25111640-25111662 CAGGCCCACCTGGATTATCCAGG - Intronic
927905606 2:26853789-26853811 GAGGCCCACCCACATTATCAAGG + Intronic
927939064 2:27092478-27092500 AAGGCCTGCCTGCATCATTGTGG + Intronic
928410615 2:31051362-31051384 GAGGCCCACCCATATTATGGAGG - Intronic
928783600 2:34854584-34854606 GAGCACCACCTGGATTCTTGAGG + Intergenic
929339150 2:40791861-40791883 GAGGACCACTTACATTATGGAGG + Intergenic
929586527 2:43119076-43119098 GAGGCCCACCTGCATCATGGAGG + Intergenic
930160584 2:48152459-48152481 AAGGCCCACCTATATTATGGAGG + Intergenic
930457436 2:51623422-51623444 GAGGCCCACAGACATTATGGAGG - Intergenic
930598587 2:53417584-53417606 GAGGCCCACCCACATTACAGAGG + Intergenic
931073170 2:58678010-58678032 GAGGCCCACCCACATTATAGAGG + Intergenic
931829833 2:66039219-66039241 GAGGCCCATCCACATTATGGAGG + Intergenic
933205266 2:79500022-79500044 GAGGACCACCCACATTATGGAGG + Intronic
933495566 2:83046405-83046427 GAGGCCTACCCGCATTATGAAGG - Intergenic
933523412 2:83404403-83404425 GAGGCCCACCCACATTATGAAGG + Intergenic
934259215 2:91455531-91455553 AAGCCCCACCTGCAATATTGGGG + Intergenic
934302514 2:91787421-91787443 AAGCCCCACCTGCAACATTGGGG + Intergenic
934330742 2:92065348-92065370 AAGCCCCACCTGCAACATTGGGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935368872 2:102323735-102323757 AAGCCCCACCTTCAATATTGGGG + Intronic
935498296 2:103807963-103807985 GAGGCTCACCCACATTATGGAGG + Intergenic
935668892 2:105538578-105538600 GAGGCCCACCCACATTATGGAGG - Intergenic
935846723 2:107173899-107173921 GAGGTCCACTTACATTATGGAGG + Intergenic
936084656 2:109458772-109458794 GAGGCCCACCCACATTATCAAGG + Intronic
936607203 2:113970524-113970546 GTGGCCCACCAGCATCATCGGGG + Intergenic
937791765 2:125969566-125969588 CAGGCCCACCTCCAACATTGAGG - Intergenic
937942242 2:127294935-127294957 GAGGCCCACCCGCATTATTGAGG - Intergenic
937958128 2:127434713-127434735 GCAGCCCACCTGCATTATGGAGG + Intergenic
938244216 2:129764893-129764915 GAGGCCCACCTACACTATGGAGG - Intergenic
938506227 2:131886672-131886694 GAGGCCCACCTACATTAACGAGG + Intergenic
938520070 2:132060441-132060463 AAGCCCCACCTGCAACATTGGGG - Intergenic
939468621 2:142590454-142590476 GAGTCCCACTTACATTATAGAGG - Intergenic
939768019 2:146277677-146277699 GAGGCCCACATACATTACGGAGG + Intergenic
939813814 2:146869515-146869537 GAGGCCCACCCAAATTATGGAGG - Intergenic
940205999 2:151202464-151202486 GAGGCTCACCCACATTATGGTGG - Intergenic
940413504 2:153393709-153393731 AAGGCCCACCCACATTATGGAGG - Intergenic
941299637 2:163785338-163785360 GAGGCCCACCCACATTAGGGAGG - Intergenic
941349750 2:164417476-164417498 GAGGCCCACCTACATTAGGAAGG - Intergenic
941881957 2:170489794-170489816 GAGGTCCACCCACATTATAGAGG + Intronic
942143512 2:173001868-173001890 CAGGCCCACCTCCAGCATTGAGG + Intronic
942746022 2:179234057-179234079 GAGGCCCACCTGCATTACGGAGG - Intronic
943370396 2:187009186-187009208 GAGGCCCACCCACATTTTGGAGG - Intergenic
943475666 2:188352232-188352254 GAGGCCCACCCACATTAGAGAGG - Intronic
944316041 2:198286775-198286797 GAGGCCCACCTATGTTATAGAGG - Intronic
944435275 2:199682177-199682199 GAGGCCCACCCACATTATGGAGG - Intergenic
945339958 2:208640619-208640641 AAGGCCCATCTGCATTGTGGAGG - Intronic
945464323 2:210150033-210150055 AAGCCCCACCTGCATTTTAGAGG - Intronic
945780368 2:214163879-214163901 GAGGCCCACTCACATTATGGAGG + Intronic
946133232 2:217623689-217623711 GAGGCCCACCCACATTATGGAGG - Intronic
946140824 2:217689222-217689244 GAGGCCCACCCACATTATGGAGG - Intronic
946186568 2:217983987-217984009 GAGGCCCACCTAAATTATGGAGG - Intronic
946297703 2:218798950-218798972 AAGGCCCACCTACATTACGGAGG - Intronic
946655462 2:221941202-221941224 AAGGCCCACCTACATTACGGAGG - Intergenic
946850108 2:223897705-223897727 AAGCCCCACCTGCAACATTGGGG - Intronic
947281940 2:228464684-228464706 GAGGCCCACCCACAATACTGGGG + Intergenic
947294818 2:228618626-228618648 GAGGCCCACCCACATTACAGAGG - Intergenic
947940294 2:234048421-234048443 GAGGCCCACCCACATAATGGAGG - Intergenic
948069934 2:235112544-235112566 GAGGCCCACCCACATTATGAAGG - Intergenic
948144796 2:235700281-235700303 GAGGCCCACCTACAGCCTTGAGG - Intronic
948193519 2:236078323-236078345 GAGGCCCACCTGCTTTCTCAAGG + Intronic
1169100466 20:2943465-2943487 GAAGCCCACCTACATTATGGAGG + Intronic
1169248873 20:4045281-4045303 GAGGCCCACCCACATTATGGAGG + Intergenic
1169338685 20:4779367-4779389 GAGGCCCACCCACATTATGGAGG + Intergenic
1170544824 20:17426798-17426820 GAGGCCCACGCACATTATGGAGG + Intronic
1170597084 20:17814194-17814216 GAGGCCCACCCACATTATGGAGG + Intergenic
1172305217 20:33875813-33875835 GAGGCCCACCTACATTACCAGGG - Intergenic
1173100220 20:40080524-40080546 GAGGCCAACTTGCTTTCTTGGGG - Intergenic
1173314814 20:41933457-41933479 TAGGCCCACCTCCAACATTGGGG - Intergenic
1173734620 20:45350530-45350552 TAGGCCCCCCTGCAATTTTGTGG - Intergenic
1173779723 20:45745094-45745116 GAGGCCCACCTGCATCATGAAGG - Intergenic
1174881507 20:54284073-54284095 GAGGCCCACCGGGGTTAATGAGG - Intergenic
1174975820 20:55332514-55332536 GGGCCCCACCTGCATGATTCTGG + Intergenic
1175270648 20:57731557-57731579 GAGGCCCAGGTGCATCATTGAGG - Intergenic
1175772840 20:61634516-61634538 GACCCCCACCTGGATCATTGGGG + Intronic
1175779927 20:61675907-61675929 AAGGCCCACCTGCACTGTGGAGG + Intronic
1176584932 21:8573119-8573141 AAGCCCCACCTGCAACATTGGGG + Intergenic
1176587472 21:8602210-8602232 GAGGCCCACCTAGATTATGGAGG + Intergenic
1176776576 21:13140324-13140346 AAGCCCCACCTGCAACATTGGGG + Intergenic
1176938114 21:14890042-14890064 GAGGCTCATCTACATTGTTGAGG - Intergenic
1177565660 21:22818115-22818137 TAGCCCCACCTCCATTACTGGGG + Intergenic
1177731204 21:25028688-25028710 GAGGCCCATCCACATTATGGAGG - Intergenic
1177986007 21:27975707-27975729 GAGGCCCACCTACATTAACAAGG - Intergenic
1178027057 21:28479854-28479876 GAGGCCCACCCACATTATGGAGG - Intergenic
1178366134 21:31990456-31990478 GAGACCCACCCACATTATGGAGG + Intronic
1178754141 21:35331951-35331973 AAGGCCCACCCCCATTATGGAGG - Intronic
1178877520 21:36424225-36424247 GAGGCCCACCCACATTATAAAGG + Intergenic
1179001970 21:37469788-37469810 GGGGCCCTCCTCCAATATTGGGG + Intronic
1179069363 21:38057157-38057179 GAGGTCCACCCACATTATGGAGG - Intronic
1179140980 21:38725019-38725041 GAGGCCCACCCACATTATAGAGG + Intergenic
1179190152 21:39116487-39116509 GAGGCCCACTCTCATTATGGAGG - Intergenic
1179317452 21:40256656-40256678 GAAGCCCACCCGCATTATGAAGG + Intronic
1179673321 21:42964830-42964852 GAGGCCCACGCACATTATGGAGG + Intergenic
1180267741 22:10550021-10550043 AAGCCCCACCTGCAACATTGGGG + Intergenic
1180270303 22:10579207-10579229 GAGGCCCACCTAGATTATGGAGG + Intergenic
1182828825 22:33288251-33288273 GAGGCCCACCCACATTATCAAGG - Intronic
1183056255 22:35307988-35308010 GAGGCCCACCCATGTTATTGAGG - Intronic
1183103679 22:35599557-35599579 GCGGCCCACCCTCATTATGGAGG + Intergenic
1183728635 22:39604542-39604564 CAGGACCACCTACATCATTGTGG - Intronic
1184406502 22:44303744-44303766 GAAGCTCACCTGCATACTTGGGG + Intronic
1184515687 22:44960669-44960691 GAGGGCCACCTGCTTTACTCAGG - Intronic
1184605010 22:45567782-45567804 CAGGCCCACCTGCATGACTTTGG + Intronic
1184823094 22:46926640-46926662 GAGGCCCACCTACATTGTGGAGG - Intronic
1185147101 22:49144005-49144027 AAGGCCCACCGGCATTGTGGAGG - Intergenic
1203323830 22_KI270737v1_random:97430-97452 AAGCCCCACCTGCAACATTGGGG - Intergenic
949139887 3:619543-619565 GAGGCCCACCTAGATTATGGAGG - Intergenic
949242185 3:1886430-1886452 AAGGCCCACCCACATTATGGGGG + Intergenic
949576622 3:5344911-5344933 GAGGCCCACCCACATCATGGAGG + Intergenic
949636966 3:5993349-5993371 GAGGCCCACACACATTATGGAGG + Intergenic
949840267 3:8312537-8312559 GAGGCCTACCTACATTATTGAGG - Intergenic
950512644 3:13441016-13441038 GCGGCCCACTTACATTAGTGAGG + Intergenic
950963689 3:17131233-17131255 GAGGCTCACCCACATTAGTGAGG + Intergenic
951169424 3:19522506-19522528 GAGGCCCACCCACATTAGGGAGG + Intronic
952042130 3:29273652-29273674 GAGGCCCACCTACATTACGAAGG + Intergenic
952216847 3:31286709-31286731 GAGACCCACCCACATTATGGAGG - Intergenic
953547770 3:43876299-43876321 GAGGCCCACTCACATTATGGAGG + Intergenic
954867992 3:53745862-53745884 GACGCTCACCTGCATTCTTCAGG - Exonic
954927506 3:54249339-54249361 AAGGCCCACCCACATTATAGAGG - Intronic
955299957 3:57768769-57768791 GAGGCCCACCCACATTATGGAGG - Intronic
955611545 3:60762727-60762749 GAGGCCCACTCACATTATGGAGG - Intronic
955739033 3:62069892-62069914 GAGACCCACCCACATTATAGAGG + Intronic
955931838 3:64065292-64065314 GAGGCCCACAGACATTATGGAGG + Intergenic
956374647 3:68601306-68601328 GAGGCCCACCCACATTATCAAGG + Intergenic
956684897 3:71816991-71817013 GAGGCCCACTCACATTATTGAGG + Intergenic
956694014 3:71903449-71903471 GAGGCCCACCCACAATATGGAGG + Intergenic
956736739 3:72244242-72244264 CAGGCCCACCTGCATAATCCAGG + Intergenic
957131242 3:76224499-76224521 GATGCCCACCAACATTGTTGAGG + Intronic
957251044 3:77771574-77771596 GAGGCCCACCCACATTATGGAGG - Intergenic
957298930 3:78365761-78365783 GAAGCCCATCCGCATTATGGAGG + Intergenic
957310884 3:78517113-78517135 GAGGCCCACCCACATTATGGAGG - Intergenic
957443313 3:80281634-80281656 GAGGTCCACCCACATTATGGAGG - Intergenic
957578243 3:82036324-82036346 CAGGCCCACCTCCAATATTGGGG + Intergenic
957788781 3:84914274-84914296 GAGGGCCACCTACATTAAGGAGG + Intergenic
957823807 3:85413732-85413754 AAGCCCCACCTCCAATATTGGGG + Intronic
957974057 3:87420511-87420533 GAGGCTCACCCACATTATGGAGG + Intergenic
958186741 3:90130495-90130517 GAGGCCCACCCACATCATGGAGG - Intergenic
958189479 3:90166456-90166478 GAGACCCACATGCATTATGGAGG + Intergenic
958437241 3:94112137-94112159 GAAGCCCACCCACATTATGGAGG + Intronic
958786311 3:98600120-98600142 GAGGCCCACTTACATTTTGGAGG - Intergenic
958931714 3:100214635-100214657 GAGGCCCACCCACATTATGGAGG + Intergenic
959406132 3:105963508-105963530 GAGGCCCACCCACACTATGGAGG - Intergenic
959577650 3:107951673-107951695 GAGGCCCACCCACATTATGGAGG + Intergenic
960126129 3:114000206-114000228 GATGCCCACCAACATTAGTGAGG - Intronic
960528752 3:118739961-118739983 GAGGCCCACTCACATTATAGAGG - Intergenic
961626287 3:128266130-128266152 GAAGCCCACCTACATTATAGGGG + Intronic
961644740 3:128386892-128386914 GAGGCCCACCTCCAACACTGGGG + Intronic
961930804 3:130530784-130530806 GAGGCCCACATGCATTACTGAGG - Intergenic
962400391 3:135054151-135054173 GAGGCCCATCTACATTATGGGGG - Intronic
962552391 3:136508300-136508322 GAGACCCACTCACATTATTGAGG - Intronic
962654387 3:137528248-137528270 GAAGCCCACCCACATTATGGTGG - Intergenic
963226887 3:142871571-142871593 GAGGGCCACCCACATTATCGAGG - Intronic
963420812 3:145058945-145058967 GAGGCCCACTTACATTAGGGAGG - Intergenic
963553892 3:146760936-146760958 TAGGCCCACCTCCAACATTGGGG + Intergenic
963585690 3:147185288-147185310 AAGACCCACCCACATTATTGAGG - Intergenic
963672334 3:148267759-148267781 GAGACCCACCCACATTATGGAGG - Intergenic
963931710 3:151010212-151010234 TAGGCCCACCTCCAATACTGGGG + Intergenic
964073713 3:152667237-152667259 GAGGCCTACCTGTATTATGGAGG - Intergenic
964475933 3:157097579-157097601 GCTGCCCACCTGCATTGGTGGGG + Intergenic
964539500 3:157763803-157763825 GAGGCCCACCCACTTTATGGAGG - Intergenic
964625207 3:158752119-158752141 GATGCCCACTCGCATTGTTGAGG - Intronic
966141673 3:176764471-176764493 GAGGGCCACCTACATTATGGAGG - Intergenic
966271002 3:178105572-178105594 GAGGCCTACCCACGTTATTGAGG - Intergenic
966905006 3:184515763-184515785 AAGGCTCAATTGCATTATTGGGG - Intronic
967354484 3:188552769-188552791 GAGGCTCACCTGGATAATTCAGG + Intronic
968088360 3:195884901-195884923 GAGCCTCACCTGCCTCATTGGGG - Exonic
968183839 3:196617425-196617447 GAGGCCCACTCGCATTATGGAGG + Intergenic
968688433 4:1976939-1976961 AAGGCCCAGCTGCAGAATTGGGG + Intronic
969154209 4:5195820-5195842 GAGAACCACCTGCACTATTATGG + Intronic
969192324 4:5532305-5532327 GAGGCCCACCCACATTATGGAGG + Intergenic
969429625 4:7146531-7146553 GAGGCCCACCCACATTGTGGAGG - Intergenic
969544710 4:7818114-7818136 GAGGCCCACCCACATTACAGAGG - Intronic
969909182 4:10427896-10427918 GAGGGGCATCTGCATTACTGAGG - Intergenic
969948055 4:10805181-10805203 GATGCCCACCCACATTAGTGAGG - Intergenic
969961508 4:10948999-10949021 TAGGCCCACCTAAATTATTGAGG - Intergenic
970459698 4:16261075-16261097 GGGGCCCACCCACATTATGGAGG + Intergenic
970765637 4:19545451-19545473 GAGGCCTACCTACATTAGGGAGG - Intergenic
970876889 4:20881826-20881848 GAGGCCCACCCACATTATTCAGG - Intronic
971004925 4:22362556-22362578 TAGGCCCACCTGGATTATCCAGG + Intronic
971199124 4:24495906-24495928 GAGGCTCACCTACATTATGGAGG + Intergenic
971266552 4:25100913-25100935 GAGGCCCACCCACATTATGGAGG + Intergenic
971431889 4:26577005-26577027 GAGTCCCACCCACATTATGGAGG - Intronic
971577222 4:28290867-28290889 AGGGCCCACCTCCAATATTGGGG + Intergenic
971793411 4:31197953-31197975 TAGGCCCACCTCCAATACTGGGG - Intergenic
971849346 4:31963125-31963147 GAGGCCCACTCACATTAGTGAGG + Intergenic
971940959 4:33214203-33214225 AAGCCCCACCTCCAATATTGGGG - Intergenic
973086645 4:46070850-46070872 GAGGCCCAACTACATTATAGAGG + Intronic
973193955 4:47418457-47418479 GAGGCCCACCCACATTATCGAGG + Intronic
973198770 4:47476497-47476519 GAGGCCCACCCACATTATAGAGG - Intergenic
973293975 4:48495448-48495470 AAGGCCCACCTGCATCAATGTGG + Intergenic
974022030 4:56700223-56700245 GAGGTTCACCTACATTATGGAGG - Intergenic
974130672 4:57751736-57751758 GAGGCCCACCCACATTATAGAGG + Intergenic
974152995 4:58033932-58033954 GAGGCCCACACACATTATGGAGG + Intergenic
975544412 4:75546809-75546831 GAGGCCCACCCACATTACAGAGG + Intronic
975763511 4:77641737-77641759 GAGGCCCACCAGAATTCTAGAGG + Intergenic
976277336 4:83290798-83290820 GAAGCCCACCCACATTATGGAGG - Intergenic
976395304 4:84549365-84549387 GAGGCCCACCCACATTATGGAGG - Intergenic
976690264 4:87861438-87861460 GGTGCCCACCTGCATTGATGAGG - Intergenic
978141069 4:105318042-105318064 CAGGCCCACCTCCAATACTGGGG - Intergenic
978255024 4:106682624-106682646 GAGGCCCACCCACAATATGGAGG - Intergenic
978468742 4:109038256-109038278 GAAGCCCTCCCACATTATTGAGG - Intronic
978593222 4:110349261-110349283 GAGGCCCACCTGCATTATAGAGG + Intergenic
978855451 4:113389245-113389267 GAGGCCCACCTGTATTAGGGAGG + Intergenic
979002855 4:115247630-115247652 GAGGCCCATCCACATTATGGAGG - Intergenic
979140397 4:117165117-117165139 GAGGCCCACCCACATTATGGAGG + Intergenic
979217638 4:118184352-118184374 GAGGCCCACCCACATTATGGAGG - Intronic
979346688 4:119595494-119595516 GATGCCCACCTACATTGGTGAGG - Intronic
979378705 4:119982088-119982110 GAGGCCCATCCACATTATGGAGG - Intergenic
979399343 4:120229066-120229088 GAGGCCCACTCACATTATGGAGG - Intergenic
979447758 4:120834714-120834736 GAGGCCCACCTACACTTTTTAGG - Intronic
979449380 4:120852388-120852410 GAGGCCCACCCACATTATGGAGG - Intronic
979608703 4:122667864-122667886 GAGGCACATCCACATTATTGAGG + Intergenic
980983855 4:139676568-139676590 GAGGCCCACCCACATTAAGGAGG + Intronic
981144700 4:141310934-141310956 GATGCTCACCTGCATTGGTGAGG + Intergenic
981160586 4:141494070-141494092 GAGGCTCACCCACATTGTTGAGG - Intergenic
981343107 4:143645480-143645502 GAGGCCCACCAACATTATGGAGG - Intronic
981460904 4:145012862-145012884 CAGGCCCCCCTCCATCATTGGGG - Intronic
981574937 4:146194411-146194433 GAGGCCCACCCACATTATGGGGG + Intronic
981592914 4:146384744-146384766 TAGGCCCACCTCCAACATTGGGG - Intronic
981821121 4:148888559-148888581 TAGGCTCACCTGCAACATTGGGG + Intergenic
982314018 4:154012877-154012899 GAGGCCCACCAGCATTATGAAGG - Intergenic
982678710 4:158405087-158405109 CAGCCCCACCTGCATAATTGAGG + Intronic
982726377 4:158910643-158910665 GAGGCCCACCCACATTATGGAGG - Intronic
983003354 4:162448487-162448509 GAGGCCCACCCTCCTTATGGAGG + Intergenic
983342982 4:166489768-166489790 GAGGCCCACTTAGATTATTAAGG - Intergenic
983353485 4:166625108-166625130 TAGGTCCACCTGCATAATTTAGG - Intergenic
983449199 4:167889747-167889769 GAGTCCCACCTCCAACATTGAGG - Intergenic
983857226 4:172661158-172661180 GAGGCCCATCCACATTATGGAGG - Intronic
984413878 4:179432595-179432617 GAGGCCCACCCACATTATGGAGG + Intergenic
984790751 4:183612516-183612538 GAGGCCCACCCACATTACAGAGG - Intergenic
984918343 4:184743037-184743059 GAGGCCCACCTACATTATGGAGG + Intergenic
985093675 4:186390494-186390516 TAGGCCCACCTACATTATTGAGG + Intergenic
985233843 4:187851314-187851336 GAGGCACACCTGTATGATGGAGG + Intergenic
985906123 5:2838499-2838521 TAGGCCCACCTCCAACATTGCGG + Intergenic
985934099 5:3081232-3081254 GAGACCCACCTGCATTATCATGG + Intergenic
985966299 5:3340960-3340982 GGGACCCACCTTCATTACTGAGG - Intergenic
986270556 5:6227150-6227172 GAGGCCCACCCACATTATGGAGG + Intergenic
986277589 5:6292084-6292106 GAAGCCCACCCACATTATAGAGG - Intergenic
986290532 5:6395919-6395941 GAGGCCCACCCGCATTATGGGGG + Intergenic
986314461 5:6577164-6577186 GAGACCCACCCACATTTTTGAGG + Intergenic
986384655 5:7220209-7220231 GAGGCCCAACTACATTATTAAGG - Intergenic
986417367 5:7542709-7542731 GAGGCCTACCTTCATTATCAAGG + Intronic
986429595 5:7668248-7668270 GAGGCTCACCCGCATTATAGAGG - Intronic
986646749 5:9924214-9924236 GAGACCCACCTACATTAGGGTGG - Intergenic
986732789 5:10647833-10647855 GAGGCCCACCCGCATTATGAAGG + Intronic
986901741 5:12443322-12443344 GAGGCCAATCTGCATTATAGAGG + Intergenic
987186805 5:15429761-15429783 GAGGCCCACCTGCATTATGAAGG + Intergenic
987389040 5:17358490-17358512 GAGGCCTACCTGTATTATCAAGG - Intergenic
987475268 5:18384498-18384520 AAGGCCCACCTACATTATAGAGG - Intergenic
988383388 5:30529082-30529104 GAGACCCACCTGCATTATGGAGG + Intergenic
988873631 5:35419180-35419202 AAGGGCCACCTCCAATATTGGGG + Intergenic
989340285 5:40366431-40366453 GAGGCCCACCCACATTACGGAGG - Intergenic
990835599 5:60015679-60015701 GAGGCCCATCCACATTATGGAGG - Intronic
990896482 5:60705348-60705370 GAGGCCCACCTATATTAGAGAGG + Intergenic
991043282 5:62196947-62196969 GAGGCCAACCCACATTATTAAGG - Intergenic
991112724 5:62919310-62919332 GAGGCCCACCTATATTGTGGAGG - Intergenic
991167413 5:63580196-63580218 GAGGCCCATCTGCATTAAGATGG - Intergenic
991401419 5:66255771-66255793 CAGGCCCACCTGCAACACTGAGG - Intergenic
991405536 5:66297726-66297748 GAGGCCCACCCACATTATGGAGG + Intergenic
991510420 5:67370643-67370665 GAGACCCACCCACATTATGGAGG - Intergenic
993006759 5:82436695-82436717 GAGGCCCATCTACATTATGGTGG + Intergenic
993054089 5:82960660-82960682 GAGGTCCAGATGCATTATTTTGG - Intergenic
993497898 5:88628534-88628556 GATGCCTACCTGCATTGGTGAGG + Intergenic
993835023 5:92809369-92809391 AAGGCCCACTTGCTTTTTTGGGG - Intergenic
994037822 5:95223051-95223073 GAGGCCCACCCTCATTATGGAGG + Intronic
994186494 5:96821191-96821213 GAGGCCCAGCTACATTATGGAGG + Intronic
994296689 5:98098121-98098143 GAGGCCCACCCACACTATGGAGG + Intergenic
994380624 5:99066747-99066769 GAGGCCCACCCACATTATGGAGG - Intergenic
994505949 5:100642801-100642823 GAGGACCACATACATTACTGAGG - Intergenic
994526308 5:100909227-100909249 TAGGCCCACCCACATTATGGCGG + Intergenic
994719194 5:103361403-103361425 GAGGCCTACCTACATTTTGGAGG + Intergenic
995060229 5:107805514-107805536 TAGGCCCACCTCCAACATTGGGG + Intergenic
995211853 5:109549771-109549793 GAAGCCCACCCGCATTAGGGAGG + Intergenic
995773399 5:115697919-115697941 GAGGCCCACCCACATTATGGAGG - Intergenic
996782044 5:127197880-127197902 GAGGGACACCTGCCTTTTTGAGG - Intergenic
996944158 5:129046594-129046616 GATGCCCACCCTCATTAGTGAGG + Intergenic
997093421 5:130883439-130883461 GAGGCCCACCCACATTATGTAGG + Intergenic
997391178 5:133517919-133517941 GAGGTCCACCCACATTATGGAGG + Intronic
997515530 5:134486594-134486616 TAGGCCCACCTCCAGCATTGTGG - Intergenic
998494780 5:142578625-142578647 GAGGCCCACCCACGTTATGGAGG + Intergenic
998925116 5:147114676-147114698 GATTCCCACCTGCATTAATGGGG + Intergenic
999315021 5:150578007-150578029 GAGGCCCACCCACATTAGCGAGG + Intergenic
999340618 5:150767535-150767557 GAGGTCCACCGACATTATGGAGG - Intergenic
1000262538 5:159601604-159601626 TAGGCCCACCTCCAATAATGGGG + Intergenic
1000337259 5:160251132-160251154 GAGGCCCACCCACATTATGGAGG - Intergenic
1000745665 5:165030348-165030370 GGGTCACACCTGCACTATTGTGG - Intergenic
1000832221 5:166116960-166116982 AAGGCCCACCTGAATAATTCAGG + Intergenic
1001327860 5:170742506-170742528 GAGGCCCACCCACATTATGGAGG - Intergenic
1001411320 5:171514541-171514563 GAGGCCCTCCTACATTTATGGGG + Intergenic
1001463981 5:171946054-171946076 GAGGCTTACCTACATTATGGTGG - Intronic
1001896974 5:175390894-175390916 GAGGCCCACCTACATTACAGAGG + Intergenic
1001898844 5:175405456-175405478 GATGTCCACCCGCATTAGTGAGG + Intergenic
1001905907 5:175472977-175472999 GAGGTCCACCCACATTATTGAGG - Intergenic
1002398376 5:178975848-178975870 GAGGCCCACCCAGATGATTGGGG - Intergenic
1002675861 5:180911996-180912018 TAAGCCCACCCGCATTATGGAGG - Intronic
1003409854 6:5852480-5852502 GAGGCCCACCCACATTATGAAGG + Intergenic
1003923744 6:10857431-10857453 GTGGCCCACCTGCATTATGGAGG - Intronic
1003965552 6:11249174-11249196 GAGGCCCACCAACATTATGAAGG - Intronic
1004291875 6:14374809-14374831 GAGGTCCACCCACATTATTAAGG - Intergenic
1004321488 6:14634888-14634910 GAGGCCCACCCACATTATTCAGG - Intergenic
1004576230 6:16897854-16897876 GAGGCCCACCCACATTAAGGAGG - Intergenic
1004785859 6:18966517-18966539 GAGGCCCACCCACATTATGTAGG + Intergenic
1004971490 6:20915499-20915521 GAGGCCCACCCACATTTTGGGGG + Intronic
1005368921 6:25109509-25109531 GATGGACACTTGCATTATTGTGG - Intergenic
1005687574 6:28269751-28269773 GAGGCCCACCAACATTATGGAGG + Intronic
1005835700 6:29707182-29707204 GAGGTCCATCTACATTATTGAGG - Intergenic
1005926057 6:30446637-30446659 GAGGCCCACTCACATTATGGAGG + Intergenic
1006771033 6:36553170-36553192 GAGGCCCACCCACATTATGGCGG + Intergenic
1007160594 6:39788932-39788954 GAGGCCTACCTACATTATGGAGG + Intergenic
1007164292 6:39817807-39817829 GAGGCCTACCCACATTATGGAGG + Intronic
1008498368 6:52155426-52155448 GAGGCCCACCCACATTATGAGGG + Intergenic
1008534020 6:52493006-52493028 GAGGCCCACCCACATTAGGGAGG - Exonic
1009449399 6:63783944-63783966 GAGGCCCACCCACATTAGGGAGG - Intronic
1009750720 6:67876057-67876079 AAGGCCCACCCACATTATGGAGG + Intergenic
1010015796 6:71104040-71104062 GAGGCCCACTGGAATCATTGAGG - Intergenic
1010582097 6:77612317-77612339 GAGGCCCACCCACATTAGAGAGG + Intergenic
1010623467 6:78106060-78106082 GAGTCTCACCTACATTATTAAGG + Intergenic
1011074011 6:83418485-83418507 GAGGCCCACCCACATTAGGGAGG + Intronic
1011554982 6:88564486-88564508 GAGGCCCACCTACATTGGAGAGG - Intergenic
1012091092 6:94898056-94898078 TAGGCCCACCTCCAATATTTGGG + Intergenic
1012402736 6:98857588-98857610 GAGGCCCACCCACATTACGGAGG + Intergenic
1012686184 6:102252721-102252743 GAGGCCCACCCCCATTAGAGAGG + Intergenic
1012870056 6:104661769-104661791 GAGGTCCACCAATATTATTGTGG - Intergenic
1012934699 6:105354585-105354607 GAGTCCCACCCACATTATGGAGG - Intronic
1012972619 6:105748011-105748033 GGGGCCCACCCACATTATGGAGG - Intergenic
1013196583 6:107849533-107849555 GAGACCCACCCACATTATGGAGG - Intergenic
1014069651 6:117166770-117166792 GAGGCCCACCCACATTCTGGAGG - Intergenic
1014204051 6:118636614-118636636 GAAGCCCACCCACATTATGGAGG - Intronic
1014347219 6:120287647-120287669 GAGGCCCACCCACATTATGAAGG + Intergenic
1014403621 6:121021837-121021859 GAGGCCCATCTACATAATGGAGG - Intergenic
1014451662 6:121588562-121588584 GAGGCCCACCCACATTATAGGGG - Intergenic
1014924276 6:127252918-127252940 GATGCCCACCTGCATTGGTGAGG + Intergenic
1015155973 6:130096660-130096682 GAGGTCCACCTGCACACTTGGGG - Intronic
1015679752 6:135792639-135792661 GAGGCCCACGTACATTAGGGGGG + Intergenic
1015775483 6:136809652-136809674 GAGGCCCATCTACATTATGGAGG - Intergenic
1015927156 6:138322109-138322131 GAGGCCCACCCACATTAGGGAGG - Intronic
1016284600 6:142459115-142459137 GAAGCCCACCCACATTATAGAGG + Intergenic
1016372747 6:143391818-143391840 TAGGCCCACCTCCAATACTGGGG - Intergenic
1016491394 6:144608159-144608181 GAGACCCACCCACATTATGGAGG - Intronic
1016784037 6:147990314-147990336 GAGGCCCACCCTCATTAGGGAGG - Intergenic
1017036174 6:150269373-150269395 GAGGCCCACCTGCATTGGGGAGG - Intergenic
1017176169 6:151506785-151506807 GAGGCCCACCCACATTACAGAGG - Intronic
1017284827 6:152662330-152662352 GAGGGCATCCTGGATTATTGAGG + Intergenic
1018198199 6:161373176-161373198 GAGGCCCACCCACATTATAGAGG + Intronic
1018800254 6:167216674-167216696 TAGGTCCACCTGCATTACTGGGG + Intergenic
1018812845 6:167309832-167309854 TAGGTCCACCTGCATTACTGGGG - Intronic
1019767277 7:2860921-2860943 GAGGCTCACCCACGTTATTGAGG - Intergenic
1021199460 7:17711964-17711986 GAGGTCCACCCACATTATGGAGG - Intergenic
1021758710 7:23882104-23882126 CAGGCCCACCTCCAACATTGGGG + Intergenic
1021807312 7:24370110-24370132 GAGGCCCACCCACATTAGGGAGG - Intergenic
1022244708 7:28547533-28547555 GAGGCCCACCAACATTATGAAGG + Intronic
1023994767 7:45152497-45152519 GAGGCCCACCCACATTAAAGAGG + Intergenic
1024039333 7:45538261-45538283 GAGGCACACTTACATTATGGAGG + Intergenic
1024318034 7:48039551-48039573 GAAGCCCACCCACATTATAGAGG + Intronic
1024510004 7:50196421-50196443 GAGGTCCACCTACATTACAGAGG + Intergenic
1024736573 7:52311434-52311456 GAGGCTCACCTCCATTAGGGAGG + Intergenic
1025473725 7:60892877-60892899 AAGCCCCACCTGCAACATTGGGG + Intergenic
1025479878 7:60969044-60969066 GAGCCCCACCTGCAACATTGGGG + Intergenic
1025483456 7:61015990-61016012 GAGCCCCACCTGCAACATTGGGG + Intergenic
1025513280 7:61596989-61597011 AAGCCCCACCTGCAACATTGGGG - Intergenic
1025552082 7:62263294-62263316 GAGCCCCACCTGCAACATTGGGG - Intergenic
1025557887 7:62332419-62332441 GAGCCCCACCTGCAACATTGGGG - Intergenic
1025564791 7:62420367-62420389 GAGCCCCACCTGCAACATTGGGG + Intergenic
1025962834 7:66238627-66238649 GAGGCCTTCCTGTATTATGGAGG + Intronic
1026138049 7:67680637-67680659 CAGGCCCACCTCCAACATTGGGG + Intergenic
1026233564 7:68506535-68506557 GATGCCCACCTACATTGGTGAGG - Intergenic
1027294590 7:76755771-76755793 TAGGCCCACCTCCAATACTGGGG - Intergenic
1027379673 7:77593661-77593683 GAGGCCCAACAACATTATGGAGG + Intronic
1028508470 7:91595863-91595885 GAGGCCCACCCACATTATGGAGG + Intergenic
1028811967 7:95098062-95098084 GAGGCCCACCCAGATTATTTAGG + Intronic
1029263364 7:99319639-99319661 GAGGCCCACCCACATTAGGGAGG + Intergenic
1029336065 7:99900317-99900339 GAGGCCCACCCACATTATGAAGG + Intronic
1029578833 7:101421328-101421350 AAGGCCCACCCACATTATAGAGG + Intronic
1029620468 7:101687507-101687529 GAGGTGCCCCTGCAGTATTGGGG + Intergenic
1029921715 7:104271556-104271578 GAAGCCCACCCACATTATGGAGG + Intergenic
1031293164 7:119965502-119965524 GAAGCTCACCTGCATTAAGGAGG - Intergenic
1032281734 7:130508673-130508695 GAGGCAAACCTGCATCAGTGGGG + Intronic
1032517079 7:132514573-132514595 GAGGCCCACCCACATTATAGAGG - Intronic
1032538111 7:132681411-132681433 GAGGCCCACCCACATTATGGAGG + Intronic
1032580245 7:133097312-133097334 AAGGCCCACCCACATTATTGAGG + Intergenic
1032913030 7:136455866-136455888 GAGGCCCACCTGCATCATGGAGG + Intergenic
1033015877 7:137670964-137670986 GAGCCCGACATGCATTACTGGGG - Intronic
1033455710 7:141501618-141501640 GAGGCCCACCTGTATTACAGAGG - Intergenic
1034241172 7:149612134-149612156 GAGGCCCACCCACATTTTGGAGG - Intergenic
1034330309 7:150277004-150277026 GAGGCCCAACCACATTATAGAGG - Intronic
1034647835 7:152664430-152664452 GATGCCCGTCTGCATTAGTGAGG - Intronic
1034667736 7:152832844-152832866 GAGGCCCAACCACATTATAGAGG + Intronic
1034789402 7:153954645-153954667 GAGGCCCACCCACATGATGGAGG - Intronic
1034903554 7:154923599-154923621 GAGGCCTCCCTGGATTATTTTGG + Intergenic
1035669982 8:1409693-1409715 GAGGCCCACCTGCACTGGGGTGG - Intergenic
1036153120 8:6316901-6316923 GAGGCCTACCTGCATTACGGAGG - Intergenic
1037697136 8:21233463-21233485 TAAGCCCACCTCCAATATTGAGG - Intergenic
1037708883 8:21339579-21339601 GAGACCCACCCACATTATGGGGG - Intergenic
1037938824 8:22934148-22934170 GGGCCCCACCTCCAATATTGGGG + Intronic
1038242752 8:25825012-25825034 GAGGCCCACCCAGATTATTAAGG + Intergenic
1038707270 8:29906299-29906321 GAGGCCCACCCACATTATGAGGG + Intergenic
1039090212 8:33819924-33819946 GAGGCCCACCTGTATTGAGGAGG + Intergenic
1039108707 8:34018662-34018684 TAGGCCCACCTCCAACATTGGGG + Intergenic
1039253242 8:35689745-35689767 GAGGCCCACCCACATTATGGAGG + Intronic
1039292744 8:36113941-36113963 GAGTCCCACCCACATTATGGAGG + Intergenic
1039416380 8:37397978-37398000 GAGGCCCACCCGCATTACCCAGG + Intergenic
1039665911 8:39527897-39527919 GAGGCCAACCCACATTATGGAGG - Intergenic
1039802643 8:40973302-40973324 GAGGCCCACCCACATTATGAAGG + Intergenic
1039952931 8:42185834-42185856 GAGGCCCAACTACATTATCTAGG - Intronic
1040529852 8:48257781-48257803 TAGGCCCACCTCCAATATTGGGG + Intergenic
1040653232 8:49473908-49473930 GAGGCCCATCCACACTATTGAGG + Intergenic
1040675525 8:49744716-49744738 GTGGCCCACCCACATTATGGAGG - Intergenic
1040786425 8:51170030-51170052 GAGTCCCATCTGCATTAGAGAGG + Intergenic
1040799804 8:51328055-51328077 GAGGCCCACCCACATTATGGAGG - Intronic
1041268665 8:56089460-56089482 TATGCCCACCTGCAACATTGGGG - Intergenic
1041323886 8:56644237-56644259 GAGGCCCACTTACATTATGGAGG + Intergenic
1042019798 8:64359609-64359631 GAGGACAAGATGCATTATTGAGG + Intergenic
1042320383 8:67469265-67469287 GAGGCCCACCCACTTTATGGAGG - Intronic
1042404728 8:68390961-68390983 GATGCCCACCTGCAGTATTAAGG + Intronic
1042673121 8:71286129-71286151 GGGGCACACCTCCACTATTGTGG - Intronic
1043362569 8:79492488-79492510 AGGGCCCACCTCCAATATTGAGG + Intergenic
1044639365 8:94362289-94362311 GAGGCCCACTCACATTATAGAGG - Intergenic
1045018385 8:98019450-98019472 GAGGCCCATCTACATTATAGAGG + Intronic
1045147317 8:99361229-99361251 GACACTCACCTGCATTATTGAGG + Intronic
1046035849 8:108840415-108840437 GATACCCACCTGCATTGGTGAGG + Intergenic
1046627102 8:116586661-116586683 GAGGCCCACCCACATTACAGAGG + Intergenic
1046675712 8:117105697-117105719 GAGGCCCACCCACATTATTGAGG + Intronic
1047299302 8:123599272-123599294 GAGGCCTGCCTGCATGATGGAGG + Intergenic
1047904356 8:129456961-129456983 GAGGCCCACCTGCATGATGAAGG - Intergenic
1048237437 8:132705047-132705069 GAGGCCCACCCACATTATGGAGG + Intronic
1048357561 8:133665917-133665939 GAGGCCCACCCTCATTACCGAGG - Intergenic
1048961968 8:139587512-139587534 GAGGCCCACCTACCTTATTGAGG - Intergenic
1049555702 8:143280594-143280616 GAGGCCCACCCACATTATGAAGG + Intergenic
1049937387 9:512456-512478 GAGGCCCACCCACATTATGGAGG + Intronic
1050355227 9:4776538-4776560 GAGGCCCACCCACATTGGTGAGG - Intergenic
1050451969 9:5791393-5791415 GAGGCTCACTTGCATTATGGAGG + Intronic
1050501633 9:6304440-6304462 GAGGCCCACCCCCATTATGGAGG + Intergenic
1050635148 9:7604563-7604585 TAGGCCCATCTGCATAATTCAGG - Intergenic
1050952323 9:11613433-11613455 GAGGCCCACCTGCACTAGAAAGG - Intergenic
1051027106 9:12626012-12626034 CAGGCCCACCTACATTATGGAGG - Intergenic
1051213743 9:14774290-14774312 GAAGCCCACTTGCATTATGGAGG - Intronic
1051497382 9:17738853-17738875 GAGGCCCACCCACATTATGAAGG + Intronic
1051599594 9:18859390-18859412 GAGGCCTACTTGCATAATCGAGG + Intronic
1051897045 9:21997688-21997710 GAGGACCACCCATATTATTGAGG + Intronic
1052468416 9:28860340-28860362 GAGGCCTACCCACATTATAGAGG - Intergenic
1052620583 9:30903780-30903802 GAGGCCCACATACATTTTGGTGG + Intergenic
1052670947 9:31556474-31556496 GAGGCCCACCTACATTATTGAGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1052893878 9:33729665-33729687 GAGGTCCACTTACATTATGGGGG - Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053945366 9:43303509-43303531 AAGCCCCACCTGCAACATTGGGG - Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054442600 9:65280640-65280662 AAGCCCCACCTGCAACATTGGGG - Intergenic
1054487679 9:65740862-65740884 AAGCCCCACCTGCAACATTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055335310 9:75227581-75227603 CAGGCCCACCTCCAGTATTGGGG + Intergenic
1056217995 9:84423147-84423169 GAGGCCCACCCACATCATTGAGG + Intergenic
1057057557 9:91975451-91975473 GAGGCCCACCCCCATTATGAAGG + Intergenic
1057627299 9:96688821-96688843 GAGGCCCACCCACGTTATGGAGG + Intergenic
1058157405 9:101530959-101530981 GAGGCCTACCTACATTTTGGAGG - Intronic
1058667551 9:107334382-107334404 GACACCCACCTGCATTGGTGAGG + Intergenic
1058865620 9:109159717-109159739 GAGGCCAACTTGCATTATGGAGG - Intronic
1059358029 9:113716406-113716428 AAGGCCCACCCCCATTATAGAGG + Intergenic
1059462463 9:114442551-114442573 TAGGCCCACCTGCAACACTGGGG - Intronic
1059592230 9:115674119-115674141 GAGGCCCACCTACATTAGCAAGG - Intergenic
1059793452 9:117665300-117665322 GAGGCCCAGCCACATTATGGAGG + Intergenic
1060002132 9:119968465-119968487 TAGACCCACCTGAATAATTGAGG - Intergenic
1060447172 9:123700641-123700663 GAGGACCACCAACATTATGGAGG + Intronic
1203588501 Un_KI270747v1:32087-32109 AAGCCCCACCTGCAACATTGGGG - Intergenic
1203614838 Un_KI270749v1:50638-50660 AAGCCCCACCTGCAACATTGGGG + Intergenic
1203617434 Un_KI270749v1:80392-80414 GAGGCCCACCTAGATTATGGAGG + Intergenic
1186365692 X:8890966-8890988 GAGGCCCACCCACATTATGTAGG - Intergenic
1186562281 X:10625267-10625289 GTGGCCCACCTACATTATCAAGG + Intronic
1186764189 X:12754368-12754390 GAGGCCCACCCATATTATGGAGG + Intergenic
1187081884 X:15998684-15998706 CAGGCCCACCTCCAACATTGGGG + Intergenic
1187137114 X:16558698-16558720 GAGGCCCACCCACATTAGGGAGG + Intergenic
1187421002 X:19133642-19133664 GAGGGCCACTTGGAGTATTGAGG - Intergenic
1187766182 X:22644863-22644885 GATGCCCCCTTGCATTAATGTGG - Intergenic
1187797927 X:23024677-23024699 GAGACCCACATACATTATGGAGG - Intergenic
1188478168 X:30609170-30609192 GAGGCCCTCCCACATTATGGAGG + Intergenic
1188587562 X:31796716-31796738 AAGCCCCACCTCCAATATTGAGG - Intronic
1188783690 X:34317008-34317030 GAGGCCCTCCCACATTATGGAGG - Intergenic
1189425033 X:40892007-40892029 GAGGCCCACCTACATTATAGAGG + Intergenic
1189472731 X:41326865-41326887 GAGGCCTGCCTGCAATATGGAGG + Intergenic
1189631317 X:42956692-42956714 AAGGCCCACCAACATTATGGAGG + Intergenic
1190045426 X:47108112-47108134 GAGGCCCGTGTGCATTATGGAGG - Intergenic
1190653591 X:52591562-52591584 GAGGCCCACCGACATTATAGAGG - Intergenic
1190683922 X:52853495-52853517 GAGGCCCACCCACATTGTGGAGG + Intergenic
1190888772 X:54551498-54551520 CAGGCCCACCTTCGTGATTGGGG + Intronic
1191587783 X:62847875-62847897 GAGGCCCACCCACATTATGGAGG - Intergenic
1191673566 X:63771532-63771554 GAAGCCCACCTACATTATGCAGG - Intronic
1191977348 X:66888020-66888042 GAGGCTCACTCACATTATTGAGG + Intergenic
1192781475 X:74297645-74297667 GAGGCCGACCCACATTATGGAGG - Intergenic
1192824310 X:74679067-74679089 GAGGCCCAGCCACATTATTGAGG - Intergenic
1192896596 X:75448911-75448933 GAGGCCCACCTGCATTGGGGAGG - Intronic
1193519217 X:82508550-82508572 GAGGCCCACCCTCATTATAGAGG - Intergenic
1194044023 X:88979527-88979549 GACGCCCACCTACATTATAAAGG + Intergenic
1194087618 X:89548248-89548270 GGGGCCCACCCACATTATAGAGG + Intergenic
1194279190 X:91926324-91926346 GAGGCCCACCCACATCATGGAGG + Intronic
1195287810 X:103402425-103402447 GAGGACCACCCACATTATAGAGG + Intergenic
1195300668 X:103526963-103526985 GAGGCCCACCCACATTATAGAGG - Intergenic
1196284656 X:113864829-113864851 GAGGCCCACCCACATTATTGAGG - Intergenic
1196689924 X:118548454-118548476 TGGGCCCACCCGCATAATTGTGG - Intronic
1197357709 X:125456974-125456996 GAGGCCCACTCACATTATGGAGG + Intergenic
1198010798 X:132551689-132551711 GAGCCCCACCTTCAACATTGAGG - Intergenic
1198204794 X:134455629-134455651 GAGGCCCACTCACATTATGGAGG + Intergenic
1198502231 X:137262148-137262170 GAGGCCCACCCAGATTATAGAGG - Intergenic
1198748458 X:139914600-139914622 GAGGCCCACCCACATTATGGAGG - Intronic
1198845888 X:140910040-140910062 GAGGCCCATCCACATTATGGAGG - Intergenic
1198978248 X:142361966-142361988 GAAGCCCAACTACATCATTGCGG + Intergenic
1199590708 X:149465821-149465843 GAGGCTCACCCACATTATGGAGG - Intergenic
1199657215 X:150008002-150008024 GAGGCCCACCCACATTATGGAGG - Intergenic
1199689173 X:150294487-150294509 GATGCCCACCTACATTAGGGAGG - Intergenic
1199693244 X:150325131-150325153 GAGGCCCACCTACATAATGGAGG + Intergenic
1199718939 X:150528061-150528083 GAGGCCCACCCACATCATCGAGG - Intergenic
1199872031 X:151907075-151907097 GAGGCACACCCACATTATGGAGG + Intergenic
1200016870 X:153171460-153171482 GAGGCCCACCAACATTATGGAGG + Intergenic
1200440261 Y:3204118-3204140 GGGGCCCACCCACATTATAGAGG + Intergenic