ID: 909356395

View in Genome Browser
Species Human (GRCh38)
Location 1:74714858-74714880
Sequence GGCACTATGCTGCTGGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909356391_909356395 14 Left 909356391 1:74714821-74714843 CCTTGAACAAATATTTATTGGGA 0: 1
1: 0
2: 12
3: 116
4: 575
Right 909356395 1:74714858-74714880 GGCACTATGCTGCTGGACACTGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909356395 Original CRISPR GGCACTATGCTGCTGGACAC TGG Intronic
902374131 1:16022361-16022383 CACAGTCTGCTGCTGGACACAGG + Intronic
902379082 1:16044219-16044241 CCCAGTCTGCTGCTGGACACAGG + Intronic
906737688 1:48147754-48147776 GGCACTACCATCCTGGACACTGG + Intergenic
907461862 1:54609911-54609933 GGCATGATCCTGCTGAACACTGG - Exonic
909356395 1:74714858-74714880 GGCACTATGCTGCTGGACACTGG + Intronic
916568309 1:166002569-166002591 GGCAATATGATCCTGGACATAGG - Intergenic
921986968 1:221322703-221322725 GGCACTAAGCTGGTTGAAACTGG - Intergenic
922008797 1:221559765-221559787 GTCACTATGCTCCTTGCCACAGG + Intergenic
1062909684 10:1204704-1204726 GTCACGATGGTGCTGGACACAGG - Intronic
1070220552 10:74438554-74438576 GGCACTATGCTGGTTGCCAGAGG - Intronic
1075917407 10:126180820-126180842 GGCACTGTGCTTCTGGAGAGAGG + Intronic
1076208824 10:128624707-128624729 TGCACCATGCTGGTGGACGCAGG - Intergenic
1076536166 10:131179067-131179089 GGCACCATGCTGGTGGAAGCCGG + Intronic
1077019048 11:409435-409457 GGCCCTCTGCTCCTGGCCACAGG + Intronic
1077230365 11:1455864-1455886 GGACCTATGGTGCTGGGCACTGG - Intronic
1078082676 11:8215704-8215726 GGCATTATTTTGCTGGACAAAGG + Intergenic
1079172926 11:18113183-18113205 GGAACTATGATGCTGTACAAAGG - Intronic
1081168322 11:39834509-39834531 GGCAATATGATTCTGGACATAGG + Intergenic
1084640303 11:70421875-70421897 GGCAGAATGCTGCTGGAGACCGG - Intronic
1088772997 11:113054317-113054339 GGCACTATACTGGCTGACACCGG - Intronic
1089319330 11:117614256-117614278 GACACTGGGCTGGTGGACACTGG - Intronic
1094193175 12:27717590-27717612 GGTACTCTGTTGCTGGAGACAGG + Intronic
1096704570 12:53411046-53411068 GGCACTTTGCCCCTGGACAGTGG + Exonic
1096955015 12:55517234-55517256 GGCAATGTGCTGGTGGGCACAGG - Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1102143013 12:110632162-110632184 GGAACTAGGTGGCTGGACACAGG - Intronic
1102181825 12:110918430-110918452 GGCACGAGGCTGCTGGGCATAGG + Intronic
1104301343 12:127567875-127567897 ACCACTAGGCTGCTGGACAGAGG + Intergenic
1106737345 13:32601057-32601079 TGCCCTATGCTGCTGCAAACTGG + Intronic
1110330653 13:74268478-74268500 GGTAATATGCTGCTGGTCATGGG + Intergenic
1112359462 13:98704480-98704502 GGCACTATGCAACTGAACGCTGG + Intronic
1117082320 14:52165170-52165192 GGAACTAAGCTGGAGGACACCGG + Intergenic
1117821030 14:59649320-59649342 GGCAATATCATTCTGGACACTGG + Intronic
1122609836 14:102974454-102974476 GGCACTGTGCTGGGTGACACAGG - Intronic
1123931202 15:25172494-25172516 GGCACCTGGCTGATGGACACTGG - Intergenic
1123932053 15:25176690-25176712 GGCACTTGGCTGATGGCCACTGG - Intergenic
1123948587 15:25250729-25250751 AGCACCAGGCTGATGGACACTGG - Intergenic
1124372794 15:29112972-29112994 GACACTATGCTGCATGAAACAGG - Intronic
1126864171 15:52919747-52919769 GGCACCTTGCTCCTGGAAACTGG + Intergenic
1128552344 15:68606437-68606459 GGCCCTATGCTGGGGAACACAGG - Intronic
1128705715 15:69836338-69836360 GGAAGGATGCTGCTGGCCACGGG - Intergenic
1131048102 15:89328906-89328928 AGCACTATGCTCCTGCCCACCGG + Intronic
1140148241 16:72333167-72333189 GGCAGGATGCTGGTGGGCACAGG + Intergenic
1140687901 16:77451202-77451224 GGCAAATTGCTGCTGGAAACTGG + Intergenic
1141574966 16:84957972-84957994 GGCACTATCATGGTGGCCACTGG + Intergenic
1142666851 17:1468211-1468233 AGCACCGTGCTGCTGGACTCAGG + Intronic
1144640706 17:16935123-16935145 GACACTCTGATGCTGGCCACAGG - Intronic
1145889982 17:28407486-28407508 GGCACTGTGCTGGGGGACTCCGG + Intergenic
1146640320 17:34535901-34535923 GGCCCTTTCCTGCTGGAGACAGG + Intergenic
1151418755 17:73983947-73983969 GGAACCAGGCTGCTGGACACGGG + Intergenic
1154208887 18:12361978-12362000 GGCACTATGCTGCTGGTCCTGGG - Intronic
1155133030 18:22957699-22957721 GGAACCATGCTGATGGAAACAGG + Intronic
1157506561 18:48230723-48230745 GGCGCCATGCTGCTGGCCTCAGG - Intronic
1159135582 18:64333064-64333086 GGCAGTTTGCTTTTGGACACTGG + Intergenic
1163330912 19:16637133-16637155 GCTACTGTGCTGCTGAACACAGG + Intronic
1165061826 19:33208515-33208537 GGGGCTTTGCTGCTTGACACAGG - Exonic
925910896 2:8573032-8573054 AGCACTGTGCTGATGGACTCTGG - Intergenic
926111313 2:10185939-10185961 AGCAGTAGGCTGCTGGACAGAGG + Intronic
926292224 2:11540190-11540212 GCCATTATTCTGCTGAACACAGG - Intronic
932977345 2:76619478-76619500 GGGAAAATTCTGCTGGACACTGG - Intergenic
934990834 2:98920491-98920513 AGCACTTTCCTGCGGGACACAGG + Intronic
935973565 2:108555386-108555408 GGCACTCACCTGCTGGTCACAGG + Intronic
941993709 2:171581601-171581623 GGCAATACGATTCTGGACACAGG - Intergenic
942249607 2:174036597-174036619 GGCACCAAGATGCTGGACAAAGG - Intergenic
947631420 2:231655820-231655842 GGCAGGATGCTGCTGTCCACTGG + Intergenic
947759613 2:232594193-232594215 GGCATTTTGCTGCTTGACACTGG - Intergenic
1169220031 20:3816835-3816857 GGCACCATGCTGTGAGACACTGG + Intergenic
1172451348 20:35026145-35026167 GACACTATGCTGCTGGCCTGAGG - Intronic
1175162452 20:57019109-57019131 AACACTATGCTGCTGGACCGAGG + Intergenic
1175177361 20:57120297-57120319 GGCACTTTCCTGCTGGAGCCGGG + Intergenic
1175711898 20:61227989-61228011 GGCATTATTCTGCTGGCCACAGG - Intergenic
1176365763 21:6031953-6031975 TGCACTGTCCTGCTGGCCACAGG + Intergenic
1179757753 21:43506592-43506614 TGCACTGTCCTGCTGGCCACAGG - Intergenic
1180783786 22:18535898-18535920 GTCACTATCATGTTGGACACGGG - Intergenic
1181240686 22:21475250-21475272 GTCACTATCATGTTGGACACGGG - Intergenic
1181560841 22:23698681-23698703 GGCTCTCTGCAGCTGGCCACGGG - Intronic
1182799596 22:33020752-33020774 AGCACTCTGGTGCTGGACACAGG + Intronic
1183484518 22:38082008-38082030 GTCACGAGGATGCTGGACACGGG + Exonic
1184771431 22:46598986-46599008 GGCACTGAGCTGGTGGGCACCGG - Intronic
1185333056 22:50260250-50260272 GGCACTTTGCTGGTGGACGCAGG + Intronic
950903620 3:16518005-16518027 GGAGATATGCTGCGGGACACTGG - Intergenic
954741501 3:52754718-52754740 TGCACTTTCCTGCTGGACTCTGG + Intronic
959042031 3:101432524-101432546 GTCACAATGCTGGTGGCCACAGG + Intronic
963605653 3:147410107-147410129 GCCACGATGCTCCTGGACGCCGG + Exonic
967939755 3:194756770-194756792 GGCATGATCCTGCTGGACACTGG + Intergenic
968619509 4:1597458-1597480 GGAACCATGCTGCTGGGCCCAGG + Intergenic
973685313 4:53363873-53363895 GTTACTATGATGCTGGACAGTGG + Intronic
974093126 4:57333291-57333313 AGAGCTATGCTCCTGGACACGGG - Intergenic
977505644 4:97899883-97899905 GGCAATATCATTCTGGACACAGG + Intronic
979132818 4:117069526-117069548 CCCACAGTGCTGCTGGACACAGG - Intergenic
981160859 4:141497003-141497025 GGCATTATGCTGATTGAAACTGG + Intergenic
983022918 4:162700748-162700770 GGCACTATGCTGCAGCAGCCTGG + Intergenic
985863427 5:2492772-2492794 ACCACGCTGCTGCTGGACACAGG + Intergenic
986351166 5:6880721-6880743 TGCACTAAGCTGCTGCACAGAGG + Intergenic
987912882 5:24171272-24171294 TGCACTTTCCTGCTGGACTCTGG + Intronic
989214280 5:38888104-38888126 GCCACTATTCTGCTGCACATGGG - Intronic
996681342 5:126230546-126230568 GGCAATACCCTCCTGGACACAGG + Intergenic
997976451 5:138444341-138444363 GGGCCGGTGCTGCTGGACACAGG + Intronic
999890558 5:155974651-155974673 GGGACTTTCCTGCTGGACATAGG + Intronic
1006949885 6:37812947-37812969 AGCCCTATCCTTCTGGACACAGG - Intergenic
1007216176 6:40240602-40240624 GGCAATATCATCCTGGACACAGG + Intergenic
1016900189 6:149093301-149093323 GGCACTATGCTGGTGGAAGGTGG - Intergenic
1024518790 7:50284596-50284618 CCCACTATGCTGCTGGCCACAGG + Intergenic
1028284264 7:88975853-88975875 GGCAAAATTCTGCAGGACACTGG - Intronic
1028533571 7:91865396-91865418 TGCACTATTGTGCTTGACACTGG - Intronic
1029367809 7:100127627-100127649 GGCCCCATCCTGGTGGACACCGG + Exonic
1033819039 7:145111190-145111212 GGCAATATCATACTGGACACAGG - Intergenic
1034501017 7:151451227-151451249 GTCACTATTCTGCTGACCACAGG + Intergenic
1035249304 7:157586668-157586690 GGCCCCCTGCTACTGGACACTGG + Intronic
1037614541 8:20506853-20506875 GGCACTATGCCCCTAGACATGGG - Intergenic
1037946707 8:22994206-22994228 TGCACAAAGCTGCTTGACACTGG - Intronic
1038388417 8:27171913-27171935 TGCACTTTGCTGTGGGACACTGG + Intergenic
1039414469 8:37381781-37381803 GGCACTAAGCTGATGGAGAGAGG - Intergenic
1044370571 8:91405578-91405600 GGCACCATGCTGGTTGATACAGG + Intergenic
1047365145 8:124204453-124204475 GGCACTGTGGTCCAGGACACAGG + Intergenic
1048545541 8:135383542-135383564 GGCACTACCATTCTGGACACAGG - Intergenic
1049808705 8:144553552-144553574 AGTACTCTGCTGCTGCACACTGG + Intronic
1050662343 9:7896175-7896197 GGCATTGTGCTGCTGGTCTCTGG - Intergenic
1053509449 9:38675282-38675304 GGCACAATGCTGCTGGTTGCTGG - Intergenic
1055228987 9:74038515-74038537 GGCATTATGCTATTGGACATGGG + Intergenic
1057877304 9:98767850-98767872 GGCACTGGGCTGCTGCACAGTGG - Intronic
1058835963 9:108858905-108858927 GTCACTAGGCTGTGGGACACTGG + Intergenic
1060552708 9:124493037-124493059 GGCAGCATCCTGCTGGTCACCGG - Exonic
1062365182 9:136204996-136205018 GCCGCGATGCTGCTGGAAACGGG - Intronic
1188230872 X:27661047-27661069 GGCACTGTGCTGCTGCAGCCTGG + Intronic
1190802915 X:53808519-53808541 GAGACTATGGTGCTGTACACAGG + Intergenic
1193718525 X:84960028-84960050 GGCACTACCATTCTGGACACAGG + Intergenic
1193854784 X:86586492-86586514 GGCAATATTCTTCTGGACATAGG - Intronic
1194204074 X:90989591-90989613 GGCACTACGGTGGTGGATACAGG - Intergenic
1200050188 X:153425124-153425146 GGCACTTTGCTGAGGAACACAGG - Intergenic
1200549916 Y:4565031-4565053 GGCACTACGGTGGTGGATACAGG - Intergenic