ID: 909357212

View in Genome Browser
Species Human (GRCh38)
Location 1:74723596-74723618
Sequence TTGGCTACTCATAACCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909357212_909357215 -1 Left 909357212 1:74723596-74723618 CCCTCATGGTTATGAGTAGCCAA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 909357215 1:74723618-74723640 AGTAACTGAGTTCTAGCCAATGG 0: 1
1: 0
2: 18
3: 79
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909357212 Original CRISPR TTGGCTACTCATAACCATGA GGG (reversed) Intronic
902981376 1:20125914-20125936 TTGGTTGCTCATAACCTGGAAGG - Intergenic
905891354 1:41520470-41520492 TTGCCTTCTCATGACAATGAGGG - Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
909357212 1:74723596-74723618 TTGGCTACTCATAACCATGAGGG - Intronic
913500066 1:119464336-119464358 GTGGCAACTGATAAGCATGAGGG + Intergenic
918391928 1:184074427-184074449 AAGGCTACTAATAACCATGTGGG - Intergenic
921722258 1:218486228-218486250 TTCCCTACTCACAACCATAATGG + Intergenic
1063917946 10:10903682-10903704 GTGGATACTCATCACCATGGAGG - Intergenic
1065087445 10:22193391-22193413 TCTACTACTCATACCCATGAAGG - Intergenic
1065834955 10:29648533-29648555 TTGGCTGCTCATCATGATGAGGG - Intronic
1067897081 10:50194229-50194251 TTTTCTACTCATGTCCATGAGGG - Intronic
1067951891 10:50747811-50747833 TTTTCTACTCATGTCCATGAGGG + Intronic
1068390467 10:56389489-56389511 GTGGCTAATCATTACCATGCTGG + Intergenic
1069111181 10:64448754-64448776 TATGCTATTCATAACCATGTTGG + Intergenic
1077091089 11:778570-778592 TTGGCTGTTCCCAACCATGACGG - Intronic
1081084281 11:38779976-38779998 TTATCTACTTATAACCAAGATGG + Intergenic
1087535676 11:99442149-99442171 TTAGCTACCCATAGCTATGAGGG + Intronic
1091019085 11:132082528-132082550 TTGCCTAATCATGCCCATGATGG - Intronic
1092150356 12:6243893-6243915 ATGGCTACTCATAGCTATAAGGG + Intergenic
1099723587 12:86396532-86396554 TTGGCTACTTATAATTATAATGG + Intronic
1105802541 13:23920893-23920915 TTGGGTACTCATAGACATAAAGG + Intergenic
1117904876 14:60574298-60574320 CTTGCTACTCAAAGCCATGATGG + Intergenic
1124200678 15:27676508-27676530 CTGCCTACTCAGAACCATGCAGG - Intergenic
1127051243 15:55086426-55086448 TTTGCTACTAAAAACCAAGAGGG + Intergenic
1127883701 15:63180159-63180181 TTGTATTCTCATAACCTTGATGG + Intergenic
1132090927 15:98947487-98947509 TAGGCTACTCATCACCAAGTAGG - Intronic
1132345649 15:101107199-101107221 TTGGAGACTCAAAACAATGATGG + Intergenic
1140639903 16:76959754-76959776 TTGGCTAATCATCTCCATGGTGG + Intergenic
1155610069 18:27656984-27657006 TTGTCTAATCATAACCATGTTGG + Intergenic
925803189 2:7622587-7622609 ATGGCTGCTCATAATTATGAAGG - Intergenic
926503762 2:13685417-13685439 TTGGCTAATAGTAACTATGAAGG + Intergenic
932102140 2:68910571-68910593 TTGGTTACTCAGAACAATGCTGG - Intergenic
932445483 2:71778293-71778315 TTGGCTTCTCTGAAACATGATGG + Intergenic
932936000 2:76102101-76102123 TTGGGTACTCATAGACATAAAGG + Intergenic
933445265 2:82371786-82371808 TTGCCAATTCATAAGCATGATGG - Intergenic
938738056 2:134204472-134204494 TTGGCTAGCCAGAACTATGATGG + Intronic
938942237 2:136179439-136179461 TTCTCTACCCATAACCTTGAGGG + Intergenic
943574087 2:189610404-189610426 TTGGCAAGTCAGCACCATGAAGG + Intergenic
945795507 2:214358007-214358029 TTGTCTACCCAGAACCATGCTGG + Intronic
946016050 2:216604870-216604892 TTGGCTTCTCATAATCCTGCAGG - Intergenic
1178144923 21:29728272-29728294 TTGGCTACTCATGTGCAGGATGG + Intronic
1185245573 22:49771192-49771214 TTGGCTTTTCAGAACCAGGAGGG - Intergenic
951260136 3:20497432-20497454 TTGGGTACACACAAACATGAAGG - Intergenic
957291846 3:78287274-78287296 TTGGTTACTCATTACAGTGATGG + Intergenic
958138138 3:89523582-89523604 CTTGCTACTCATAAACATAAGGG + Intergenic
962747879 3:138410966-138410988 TTGGCAACCCATCACCAGGATGG + Intergenic
972576166 4:40354030-40354052 GTGGATATTCATCACCATGATGG - Exonic
980282042 4:130735286-130735308 TTGGGTACTCATGAACATAAAGG + Intergenic
980338639 4:131510915-131510937 TTAGCTACTGATAATCAAGAAGG + Intergenic
981595552 4:146417750-146417772 TAGGCTACTCTTAACCTTTATGG - Intronic
982381844 4:154757327-154757349 TTGGCTCATCATAAACAAGAAGG - Intergenic
984308457 4:178025247-178025269 TTGGATACTCACATCCATAAAGG + Intergenic
984933471 4:184868805-184868827 CTGCCTACTAAAAACCATGATGG - Intergenic
985590489 5:761968-761990 CTGGCCACTCACAGCCATGATGG + Intronic
987584639 5:19838876-19838898 TTGGTTTCTCATCACCTTGATGG + Exonic
988533762 5:32048424-32048446 TAGGCTTCTCAAAACCATGAAGG + Intronic
995998490 5:118329088-118329110 TTGTCTACACATAACAATGCAGG - Intergenic
1005015669 6:21373299-21373321 TTGGCTACTGATAACAGGGATGG + Intergenic
1006656709 6:35600932-35600954 TTGGCTACTAATAAACATGTTGG + Intronic
1007213692 6:40219252-40219274 TTGGCTGCTCCTAACTGTGATGG + Intergenic
1007952405 6:45884142-45884164 TTGGCTACTCTTCAACATGTTGG + Intergenic
1011043790 6:83059803-83059825 TTGGTTTCTCATATCCATGCTGG - Intronic
1011911720 6:92449184-92449206 TTGGCCACTCCTAGCCATGTGGG - Intergenic
1015064855 6:129012145-129012167 TTGGCTATCCACCACCATGAGGG + Intronic
1021806042 7:24356835-24356857 TTGGCTTCTAAAAACCATGCTGG - Intergenic
1028942499 7:96538903-96538925 TTTTCTAGTCAGAACCATGAAGG + Intronic
1032319262 7:130870542-130870564 TTGGCTATTCAGAATGATGACGG - Intergenic
1039318730 8:36403910-36403932 ATGGCAATTCATAAGCATGAGGG + Intergenic
1039789077 8:40859752-40859774 TTGGCTGCTCATAGTCATCAAGG - Intronic
1044252671 8:90022425-90022447 CTGGTTACTCATTTCCATGATGG + Intronic
1044885738 8:96775033-96775055 TCAGCTATTTATAACCATGATGG - Intronic
1048000060 8:130371748-130371770 TGGGCTCCTGATAACCATGGAGG + Intronic
1048124701 8:131620977-131620999 TTGGGTACTCATGGACATGAAGG + Intergenic
1050997048 9:12233666-12233688 TTGCCTACTTCTAACCATAAAGG - Intergenic
1052056224 9:23910751-23910773 GTGGCTATTCACAAGCATGATGG - Intergenic
1054782510 9:69178000-69178022 ATGGCTACCCATAACAGTGACGG + Intronic
1061085708 9:128396998-128397020 TTGGCTCCTCATTTCCCTGAGGG - Intergenic
1062344332 9:136107966-136107988 TTTGCTTCTCAGAACCAAGAGGG - Intergenic
1186878225 X:13838485-13838507 GTGGCAACTCAAAACCATCAGGG + Intronic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192988340 X:76424740-76424762 TTGGGTACTCATCAACATAAAGG + Intergenic
1195375594 X:104224476-104224498 GTGGCTTCTAATAAGCATGAGGG + Intergenic