ID: 909357930

View in Genome Browser
Species Human (GRCh38)
Location 1:74730690-74730712
Sequence ACCCAAGTCCTGTAATTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909357930 Original CRISPR ACCCAAGTCCTGTAATTAAA TGG Intronic
904768022 1:32865075-32865097 ACCAAAGTGCTGGAATTAACAGG - Intronic
905109604 1:35585783-35585805 CCCAAAGTGCTGGAATTAAAGGG - Intronic
905395918 1:37666453-37666475 ACCCAAGTCATGTATTTACTAGG + Intergenic
906621591 1:47285289-47285311 TCCAAAGTACTGGAATTAAAGGG + Intronic
906942206 1:50265266-50265288 ACCCAAGGCAAGTAATAAAAAGG - Intergenic
907618646 1:55952568-55952590 GCCTAAATACTGTAATTAAAAGG + Intergenic
909357930 1:74730690-74730712 ACCCAAGTCCTGTAATTAAATGG + Intronic
911422247 1:97658000-97658022 ACACAACTACTGAAATTAAAAGG + Intronic
916845510 1:168645932-168645954 ACAGAAATACTGTAATTAAAGGG + Intergenic
917380243 1:174398356-174398378 ACCCCAGTGCTGTAATCACATGG + Intronic
917742856 1:177977968-177977990 AACCCACTCCTGTAATTAATAGG - Intronic
919496625 1:198279574-198279596 ATCTAAGTCCTGTATTTACAAGG - Intronic
919955737 1:202413387-202413409 ACTTAAGTCCTGTAGTTACAAGG + Intronic
1068251626 10:54449784-54449806 GCTCAAGTCCTTTAATAAAATGG - Intronic
1071543700 10:86511085-86511107 ACCCAAGTGCTGGTATTAACAGG + Intronic
1072823416 10:98581436-98581458 ACCCTAGCCCTGGAATTCAAAGG - Intronic
1078634465 11:13036029-13036051 AACCAAGACCTGATATTAAAGGG + Intergenic
1079074061 11:17372550-17372572 CCCAAGGTCCTGTAATGAAAAGG - Exonic
1081036096 11:38148573-38148595 AACCAAGTCCTGTGCTCAAAGGG - Intergenic
1084855196 11:71979968-71979990 ACCCAACTCATGAAACTAAAAGG - Intronic
1086494003 11:87384170-87384192 TCCCAAGCCCTGTAACTAACAGG + Intergenic
1088236405 11:107728813-107728835 AACCATGTCCTGTGTTTAAAAGG - Intergenic
1088274559 11:108071507-108071529 ACCCAACTCCTTTCTTTAAAAGG - Intronic
1088994685 11:114986215-114986237 ACCCAAGGCCTGAAAGAAAATGG + Intergenic
1091124099 11:133081197-133081219 CACCAAGTCCTGTAAATATAAGG - Intronic
1091392741 12:135783-135805 GCCTAAGTCCTGTGATTACAAGG + Intronic
1093386287 12:18559357-18559379 ACACAAATCTTGTAATTTAATGG - Intronic
1095323396 12:40858110-40858132 ACCTTAGTCCTGTAACTACAAGG - Intronic
1098652173 12:72986277-72986299 TCCAAAGTCCTGGAATTAACAGG + Intergenic
1100004959 12:89883904-89883926 ACCCAAGTCAAGAAAATAAAAGG - Intergenic
1100109889 12:91227555-91227577 ACTCAATTCCTCAAATTAAATGG - Intergenic
1103112098 12:118289396-118289418 ACCCAATTCTTGGAATTAACAGG - Intronic
1103622164 12:122193900-122193922 ACCCAAGGGCTGAAATGAAAAGG - Intronic
1103646699 12:122399320-122399342 ATCCAAATCCTGTAAGCAAAAGG + Intronic
1107399965 13:40060196-40060218 ACCCAAGTCAGATAATTACACGG + Intergenic
1115854648 14:37617885-37617907 ACCCAAATCTTGTTCTTAAAAGG + Intronic
1117122512 14:52583499-52583521 TCCCAAGACCTGTAATTTTATGG + Intronic
1117832138 14:59762213-59762235 ACCCCAGGCCAGTAATTCAATGG - Intronic
1120075521 14:80153245-80153267 TCCCAAGTCCAGAAAATAAATGG - Intergenic
1120824787 14:88945342-88945364 AACCAAGTCTTGTGATGAAAAGG + Intergenic
1126661995 15:51042452-51042474 ACCCAAGCCCAGTAGTTAACTGG + Intergenic
1128221266 15:65970326-65970348 GCCCAAGCCCTGAATTTAAATGG - Intronic
1129005850 15:72372871-72372893 ACCAAAGTCCTGGGATTACAGGG - Intronic
1130642392 15:85690649-85690671 ACCCAACCACTGTAATGAAATGG - Intronic
1131802895 15:96090063-96090085 ACCCAATGCCTCTGATTAAATGG + Intergenic
1132235913 15:100221565-100221587 ACTCATGTATTGTAATTAAAGGG - Intronic
1134122635 16:11596106-11596128 TCCCAAGCACTGTAATTAATGGG + Intronic
1138115879 16:54360005-54360027 ACACAAGTCTGGTAATTACAAGG - Intergenic
1142772487 17:2108679-2108701 CCCAAAGTTCTGGAATTAAAGGG - Intronic
1145158995 17:20561922-20561944 CCCAAAGTCCTGGCATTAAAGGG - Intergenic
1145762339 17:27432695-27432717 ACCAAAGTCCTGATATAAAATGG - Intergenic
1147337360 17:39735626-39735648 CCCAAAGTCCTGGAATTACAGGG + Intergenic
1148667985 17:49388835-49388857 TCCCAAGTGCTGGAATTACAGGG - Intronic
1149785999 17:59435607-59435629 GAGCAAGTCCTGTATTTAAATGG - Intergenic
1151694962 17:75709998-75710020 CCCAAAGTCCTGGTATTAAAAGG - Intergenic
1153496844 18:5708134-5708156 ATATAAGTCCTGTAATAAAAGGG + Intergenic
1154135419 18:11773504-11773526 CCCCAAGTGCTGGGATTAAAGGG - Intronic
1155001355 18:21690340-21690362 CCCGAAGTGCTGTAATTACAGGG - Intronic
1157463798 18:47927128-47927150 AACCAGCTTCTGTAATTAAAGGG + Intronic
1159737649 18:72121372-72121394 ACTCAAGTCCTTTTATAAAACGG + Intergenic
1162573434 19:11485448-11485470 ACCCAATTCCTGTGATTGATTGG + Intronic
1164921482 19:32091914-32091936 ACCTAAGTACAGTTATTAAAGGG + Intergenic
1166796821 19:45431322-45431344 CCCAAAGTCCTGGAATTACAGGG - Intronic
925866735 2:8234691-8234713 TCTCAAGTCCTGTCATGAAAAGG + Intergenic
930265418 2:49194001-49194023 CCTCAAGTCCTGTATTTTAATGG - Intergenic
935731458 2:106067371-106067393 ATACAAGTCCTGAAAATAAATGG - Intronic
936599858 2:113885138-113885160 AGCCAAGTCCAGTAAACAAATGG - Intergenic
937505013 2:122527085-122527107 ACCTAAGTCTTTTAATTAAAAGG + Intergenic
938742514 2:134246190-134246212 ACCCAGGTCCTGAAAGTGAAAGG + Intronic
939457611 2:142458279-142458301 AGCCAAGTGATGTTATTAAATGG - Intergenic
943536734 2:189161441-189161463 ATCAAAGCACTGTAATTAAATGG - Intronic
944364514 2:198901937-198901959 ACACAAAACCTGTAAATAAATGG + Intergenic
944397736 2:199288647-199288669 TCTCAAGTCCTGTTATTAAGTGG - Intronic
946916824 2:224531345-224531367 CCCCAAGTACTGGAATTACAGGG + Intronic
947412264 2:229853399-229853421 AGCCAGGTCATGTATTTAAAGGG - Intronic
1169070059 20:2720435-2720457 ACCCAAGTCATCTAAAGAAAGGG - Intronic
1170031914 20:11953078-11953100 ACCCAAGACCTGTAAAAGAAGGG + Intergenic
1174277649 20:49415472-49415494 ACCCAGGTCCAGCACTTAAAGGG - Intronic
1174639610 20:52032231-52032253 ACACAAGTACAGTAAGTAAATGG + Intergenic
1178197277 21:30361139-30361161 ACCCTAGTCATGTAATTGAAGGG - Intronic
1178454710 21:32738055-32738077 ATGCAAGTCCAGTAATCAAAGGG + Intronic
1180501829 22:15936708-15936730 ATCCAATTGCTGTAATTCAAAGG + Intergenic
1184904281 22:47469663-47469685 AGCAAATTCCTGTAATGAAATGG - Intronic
951431573 3:22614058-22614080 ACCCAAGTCATGGAATGAAAGGG - Intergenic
951878572 3:27457115-27457137 TCCCAAGTCCAGTAGTTAGAGGG - Intronic
951935534 3:28018458-28018480 ACCCATGTCCAGCAATAAAAAGG + Intergenic
952122382 3:30261159-30261181 AACCTAGTCCTGTAATTATATGG - Intergenic
953211509 3:40879144-40879166 ACCCAACTACTCAAATTAAATGG - Intergenic
953942180 3:47109724-47109746 CCCAAAGTGCTGTAATTACAGGG - Intronic
955375708 3:58394926-58394948 AACCAGATCCTGTATTTAAAAGG + Intronic
956140298 3:66139631-66139653 ATCTAAGTTCTGTAATGAAATGG - Intronic
957907683 3:86578717-86578739 ACCCAAGCACTGTAATTACTAGG - Intergenic
958034226 3:88150585-88150607 AAGCAACTACTGTAATTAAATGG + Intronic
961706927 3:128794060-128794082 ACCCAAGACCACTAACTAAAAGG - Intronic
963639460 3:147840316-147840338 ACACATGGCCTGTAGTTAAAGGG - Intergenic
963719531 3:148845246-148845268 ATCCTAATCCTGTGATTAAATGG + Intronic
965847253 3:172978560-172978582 ACCCAACTCCTATAAATATAGGG - Intronic
969052345 4:4382128-4382150 CCCAAAGTGCTGTGATTAAAGGG + Intronic
970467779 4:16344586-16344608 TCCCAGGTCCTGGAATCAAATGG - Intergenic
971301668 4:25447009-25447031 AGCCAAGTTCGTTAATTAAAGGG + Intergenic
973617017 4:52689156-52689178 ACCCAAGTCATGTAAACTAAAGG - Intergenic
975453159 4:74553889-74553911 ACCAAAATCTTGTATTTAAATGG + Intergenic
978184545 4:105841574-105841596 TCCAAAGTCCTGTGATTAACAGG - Intronic
978829676 4:113069122-113069144 ATCAAAGTCCTGGAAGTAAAAGG + Intronic
979874770 4:125873941-125873963 CCCAAAGTGCTGTAATTACAGGG + Intergenic
980136228 4:128861364-128861386 AGCCAAGTCTTGGAATTTAAGGG - Intronic
981355129 4:143781043-143781065 ACCCAGGTGTTGTAATTAACAGG - Intergenic
981916868 4:150043480-150043502 ACCCACGTACTGTATTCAAAAGG + Intergenic
983475446 4:168206789-168206811 AGCCAGGCCCTGTAATAAAAGGG + Intergenic
983530101 4:168801698-168801720 ACCCAAGTAAAGTAATTAAAGGG + Intronic
983756720 4:171347697-171347719 ACACAATTCCTGTAATCAAAAGG + Intergenic
986237523 5:5925992-5926014 TCCCAAGACCTGTAATAAGAGGG + Intergenic
986416813 5:7537230-7537252 TCAAAAGTCCTGTAATTAAATGG - Intronic
991431023 5:66546762-66546784 GCCTAAGTACTTTAATTAAAAGG - Intergenic
992067618 5:73122064-73122086 ACCCAAGCCCTGTACTTCAGGGG - Intronic
995585162 5:113641284-113641306 ACCCAAGTCCTGGACTGCAAAGG - Intergenic
1001780540 5:174365202-174365224 AGCCAGGTCCTGTAATGGAAAGG + Intergenic
1003794318 6:9582861-9582883 GCCCAAGCTCTGTTATTAAATGG - Intergenic
1004904338 6:20222433-20222455 CCCAAAGTTCTGTAATTACAAGG + Intergenic
1010760178 6:79713848-79713870 ACCCAAGTCCTGTTATCAAAGGG - Intergenic
1011679267 6:89767496-89767518 CCCAAAGTCCTGGAATTAACAGG - Intronic
1012686294 6:102254310-102254332 ACCCAAGTCCATTAGTCAAAAGG - Intergenic
1013384515 6:109611865-109611887 ACCCAAGTACTCTATTTTAATGG - Intronic
1016137155 6:140558002-140558024 ACCCAATCCCTGAAATTCAATGG - Intergenic
1019080020 6:169424170-169424192 ACCCAAGTCCTGTTGATCAATGG - Intergenic
1020999830 7:15315037-15315059 ACCTAAGTCCTATAACTACAAGG + Intronic
1022332058 7:29389288-29389310 AGCCAAGACCAGTAAGTAAACGG - Intronic
1022753132 7:33253352-33253374 CCCAAAGTCCTGGAATTACAGGG - Intronic
1028753485 7:94409176-94409198 ACTCAAATCTTGTAATAAAACGG + Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1030827789 7:114182651-114182673 ATCCCAGTCATATAATTAAAAGG + Intronic
1032552267 7:132795350-132795372 ACCAAAGACCTTTAATGAAAAGG + Intronic
1032679976 7:134172217-134172239 ACCATGATCCTGTAATTAAATGG - Intronic
1033514606 7:142093711-142093733 AGCCAGGCCCTGTGATTAAAAGG + Intronic
1036643848 8:10600219-10600241 CCCAAAGTGCTGTAATTACAGGG - Intergenic
1042583424 8:70307578-70307600 ATGGAAGTCCTGAAATTAAATGG - Intronic
1048370528 8:133772687-133772709 ACACTAGTCCTGTAATTGAAGGG + Intergenic
1052733029 9:32311500-32311522 ACCCAAGTCCTTTCAATACATGG + Intergenic
1055991298 9:82109242-82109264 GCCCAAATCCTTTAAGTAAAAGG - Intergenic
1059383870 9:113949305-113949327 GTGCAAGTCCTGTAATTCAAGGG + Intronic
1059655556 9:116354453-116354475 ACCCAAGTCCTGTGTTTCACAGG + Intronic
1060005807 9:119998331-119998353 ACCAAAGCCATTTAATTAAACGG - Intergenic
1189411744 X:40778959-40778981 ACTCAAGTCCTTTAAATACATGG - Intergenic
1193539279 X:82752033-82752055 TCCCAAGTGCTGGAATTACAGGG - Intergenic
1194877713 X:99209493-99209515 AACCAAGTCTTATAATTAAATGG - Intergenic
1196459569 X:115916526-115916548 ACACAATTCCTGTCCTTAAAAGG + Intergenic
1196981230 X:121215541-121215563 ATCCTAGTCCTGTAGCTAAATGG + Intergenic
1198243542 X:134807688-134807710 ACCCAAGTCCATTGATCAAAGGG - Exonic
1198843844 X:140888201-140888223 ACTCCAGTCCTGTAACTATAAGG + Intergenic
1201260607 Y:12155490-12155512 ACTCAAGTCCAGGAATTAAAGGG + Intergenic
1202578871 Y:26357794-26357816 ACTTAAGTCCTGTAGTTACAAGG - Intergenic