ID: 909358788

View in Genome Browser
Species Human (GRCh38)
Location 1:74738441-74738463
Sequence CTTCAAAGCACACTAATAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909358786_909358788 11 Left 909358786 1:74738407-74738429 CCGTTATGGAATTAAATAAAGTA 0: 1
1: 1
2: 1
3: 54
4: 484
Right 909358788 1:74738441-74738463 CTTCAAAGCACACTAATAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 108
909358785_909358788 24 Left 909358785 1:74738394-74738416 CCTAATGAAAAATCCGTTATGGA No data
Right 909358788 1:74738441-74738463 CTTCAAAGCACACTAATAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909358788 Original CRISPR CTTCAAAGCACACTAATAGG TGG Intronic
901991166 1:13115056-13115078 CCACACAGCACACTAATATGGGG + Intergenic
904032900 1:27544198-27544220 CTTCACAGCAGACTATGAGGTGG - Intronic
906306035 1:44719884-44719906 CTTCAAAGCACTCTCAAAGTTGG + Intronic
907691170 1:56668180-56668202 CTTTAGAGTACACTCATAGGTGG + Intronic
909358788 1:74738441-74738463 CTTCAAAGCACACTAATAGGTGG + Intronic
913316312 1:117556199-117556221 CTTCAAAGAAAACTAAAAGTAGG + Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
924557320 1:245129295-245129317 CTTCAAAGGACACAAAAAGAGGG + Intergenic
1065327412 10:24561009-24561031 GGTCAGTGCACACTAATAGGTGG - Intergenic
1065762053 10:28991554-28991576 CTTCAAAGCACTTTAAGAGCTGG - Intergenic
1065990471 10:31004504-31004526 CATCAAATAACACTGATAGGGGG + Intronic
1072983964 10:100123133-100123155 CTTCAAAGCAAATCAATATGGGG + Intergenic
1073283397 10:102371071-102371093 CTACAAAGCAGATTCATAGGAGG - Intronic
1078682317 11:13488272-13488294 CTTCAAAGCAGATTAATAAGGGG + Intergenic
1085140023 11:74131551-74131573 CTTCAGATCAAACTAATTGGAGG + Intronic
1087130177 11:94662587-94662609 CTTCAAAGGACCCTGAGAGGGGG + Intergenic
1087705629 11:101488072-101488094 CTACATAGCACATTAATAGATGG + Intronic
1089823840 11:121253735-121253757 CTACAAAGCACAATAAAATGAGG + Intergenic
1092808704 12:12251663-12251685 ATTAAAAGCAGACTAATGGGCGG - Intronic
1093252526 12:16824838-16824860 CTACAAAGCACATTAAAATGAGG - Intergenic
1094812384 12:34151245-34151267 CTTCCAAGCACACTCATTGTGGG - Intergenic
1095910537 12:47421934-47421956 AATCAAAGCACAATAATATGAGG - Intergenic
1097464858 12:59909456-59909478 CTTCAAAGAACATCAATAGCTGG + Intergenic
1107595086 13:41955134-41955156 CTTATAAGCACATTAGTAGGTGG - Intronic
1107607431 13:42073941-42073963 CTTCATAGCAGAGTACTAGGAGG - Intronic
1109565170 13:64103980-64104002 CTCCAAAGCAAACTAAAGGGAGG + Intergenic
1113005602 13:105698564-105698586 TTTCTAAACACATTAATAGGTGG + Intergenic
1114349079 14:21830051-21830073 CTGCAAAGCACAGAAGTAGGTGG - Intergenic
1115159153 14:30373582-30373604 CTTCAAAGAACACTGAAAGCTGG + Intergenic
1117600703 14:57371534-57371556 CTTCAAAGCACATTTGCAGGGGG - Intergenic
1118435049 14:65763551-65763573 CTTAAATGTCCACTAATAGGGGG - Intergenic
1119622730 14:76144880-76144902 CTGTAAAGCACACCAAGAGGGGG - Intergenic
1124800358 15:32826677-32826699 CTCCAAAGCAAACTCCTAGGTGG - Intronic
1124891291 15:33735810-33735832 CTTCAAATCGCACCAGTAGGTGG + Intronic
1130449019 15:84032067-84032089 CTAGAAGGCACACTAATCGGGGG + Intronic
1136957074 16:34801131-34801153 CTTCTAAATACACTAAGAGGTGG + Intergenic
1143795142 17:9330183-9330205 TTTCAAAAGACACTAATAAGAGG - Intronic
1149957082 17:61063565-61063587 CTTCAAAGAACTATAACAGGAGG - Intronic
1150973047 17:70052274-70052296 TTTCAAATCATACTAAAAGGTGG - Intergenic
1153144180 18:2010558-2010580 CTGCAAAGCACAATAAAATGTGG + Intergenic
1155824090 18:30417231-30417253 TTTCAAATCACATTAATATGGGG - Intergenic
1157456290 18:47831713-47831735 CTTAAAATCACATTAATAGAAGG - Exonic
1163135332 19:15307006-15307028 CTGCAAAGCACAATAAAACGAGG + Intronic
1163910197 19:20182739-20182761 TTTCAAAGGACAGAAATAGGTGG + Intronic
1167442874 19:49519488-49519510 CTTCAAACCACAATTACAGGGGG - Intronic
924975484 2:170791-170813 CTTCAAAGCACACACAAAGAAGG - Intergenic
928288006 2:30010127-30010149 CTTCAAGGCACAGAAAGAGGAGG - Intergenic
928423356 2:31157283-31157305 CTTTAAAGAAAACTCATAGGGGG + Intergenic
932918740 2:75885238-75885260 CTCCAAAAGACCCTAATAGGAGG - Intergenic
934547729 2:95232644-95232666 CTTCAAAGCACACTGTAAGGAGG + Intronic
941016440 2:160362798-160362820 CTGCAAAGCACAGTAAAACGAGG + Intronic
943372351 2:187030271-187030293 CTTAAAAGGACACAAATAAGTGG + Intergenic
943616829 2:190102049-190102071 TCTCAAAGCACACTAATACATGG + Intronic
944258388 2:197648884-197648906 CTGATAAGCACACTAATAGAAGG - Intronic
1170481661 20:16771801-16771823 CATCAAAGAACACTACTAAGAGG - Intergenic
1181311405 22:21946758-21946780 ATTCAATGCTCTCTAATAGGAGG + Intronic
954284544 3:49609543-49609565 CTTCAAAGCACTCTACCATGTGG - Intronic
955192508 3:56774534-56774556 CTTCAAACCAGGCTGATAGGTGG + Intronic
957011270 3:75008660-75008682 GTTTAAAGCACACAACTAGGTGG - Intergenic
957538757 3:81540691-81540713 ATTCAAAGCACATTAATACTTGG - Intronic
958844360 3:99248251-99248273 CTTGAAAGCACACAAATAAATGG - Intergenic
959374709 3:105574161-105574183 CTTCAAATCACACTATTTCGTGG - Intronic
964260439 3:154829210-154829232 CTTCAAACATCACTAAAAGGTGG + Intergenic
964893180 3:161561089-161561111 CTTCAAATCACACTAGCATGAGG + Intergenic
965548881 3:169944058-169944080 CTGCAAAGCACAGTAAAATGAGG + Intergenic
965717103 3:171616895-171616917 CTTCAAAACAAACTAAAACGGGG - Intronic
966334170 3:178849965-178849987 CATCAAAGCAAGCTAAAAGGAGG + Intergenic
970899401 4:21141300-21141322 CTGCAAAGCACAATAAAATGAGG + Intronic
974816966 4:67017569-67017591 CTACAAAGCACAATAAAATGAGG + Intergenic
975733240 4:77357690-77357712 CTTCTAAGCTCACTCATAGTTGG - Intronic
978598405 4:110402835-110402857 CTGCCAAGCACAGTAATAAGGGG + Intronic
979379456 4:119992266-119992288 CTGGAAAGCAGAGTAATAGGTGG + Intergenic
981321038 4:143391566-143391588 TTTCAAAGCACAGAAAAAGGCGG + Intronic
988669793 5:33369148-33369170 CTTCAATGCACAATAAAATGAGG + Intergenic
989178080 5:38549451-38549473 CTTAAATGCTCAATAATAGGGGG - Intronic
990974918 5:61551359-61551381 CTTCAAATCACACTCATACGTGG + Intergenic
993311920 5:86344106-86344128 CTTAAAAGCACACAAATAGATGG + Intergenic
996912686 5:128673384-128673406 CTACAAAGAACACTAATATTTGG - Intronic
998185882 5:139979670-139979692 CTTCCAAGCACACTCACATGAGG - Intronic
1000008597 5:157210769-157210791 TTTCAAAACTCACTCATAGGTGG - Intronic
1000217203 5:159172061-159172083 CTGCAAAGCACAGTAAGATGAGG - Intronic
1004813380 6:19285532-19285554 CTTCAAAGGACACTAACAACAGG + Intergenic
1005296592 6:24433250-24433272 CTTCAAAGCCCATTAACAGACGG - Intronic
1008091641 6:47299803-47299825 CTAGAAAGCACATTTATAGGTGG + Intronic
1011857214 6:91709124-91709146 CTTCCAAACACAGTCATAGGAGG - Intergenic
1013451378 6:110285188-110285210 GTTCACAGCACACTATTAGAAGG - Intronic
1016032662 6:139353987-139354009 TTTCAAAGCACATTAAGAGGCGG + Intergenic
1016701796 6:147062598-147062620 ATTCAAAGCACATTTATAAGAGG + Intergenic
1023012266 7:35934909-35934931 CATCACAACACACTCATAGGTGG + Intergenic
1023450027 7:40274025-40274047 CTTGTAAGCACACCAATAGCTGG - Intronic
1025125922 7:56344999-56345021 CATCACAACACACTCATAGGTGG + Intergenic
1027630154 7:80594207-80594229 CTTCAAAGCATTCTAATACAGGG - Intronic
1028190812 7:87849535-87849557 CTTCACAGCTCACTGATAGAAGG + Intronic
1029049861 7:97674348-97674370 CTGCAAAGCACAATAAAATGAGG - Intergenic
1031163476 7:118197690-118197712 CTTCAATTCACACTCATAGGAGG + Intergenic
1031203460 7:118721974-118721996 CCCCAATGCACAGTAATAGGAGG - Intergenic
1031702793 7:124945552-124945574 GTTCATAGCACTCCAATAGGTGG - Intergenic
1035742861 8:1942148-1942170 CTTCAAAGGACACTATCAGCAGG + Intronic
1038074862 8:24060671-24060693 CTCCAAAGCACAATAGTAAGAGG - Intergenic
1040076093 8:43232732-43232754 CTGCAAAGCACAATAAAATGAGG + Intergenic
1040761409 8:50849635-50849657 CTTCAATGCACACTGATGGAAGG - Intergenic
1042829680 8:73012749-73012771 CTGCAAAGCACAATAAAATGAGG + Intronic
1044147432 8:88734500-88734522 CTTCAAATCACACAAATGGTAGG + Intergenic
1045573697 8:103396185-103396207 CTTCTAAACACACTAAAAGAGGG - Intergenic
1050282020 9:4060398-4060420 CTTCCCAGCTCACTAATAGGTGG + Intronic
1051798056 9:20898249-20898271 CATCAAACCACAGTTATAGGAGG - Intronic
1052154676 9:25170303-25170325 CTTCAAAGCACAGCACTATGAGG - Intergenic
1055086073 9:72315376-72315398 CCACACAGCTCACTAATAGGAGG - Intergenic
1056021337 9:82441176-82441198 ATCCAGAGCACACTAATATGAGG - Intergenic
1058641736 9:107093839-107093861 CTGCAAAGCACAATAAAATGAGG + Intergenic
1187734661 X:22291500-22291522 CTTCAAGGCTTACTCATAGGAGG - Intergenic
1189917609 X:45872195-45872217 CTTCTCAGCAAACTAATAGAAGG - Intergenic
1197539138 X:127733112-127733134 CTTAAAAGCACAGCTATAGGTGG + Intergenic
1198128626 X:133672473-133672495 ATTCAAAGCTCAGTAATCGGGGG + Intronic
1199852376 X:151734697-151734719 CTTCAAAGAACACTGAGAAGTGG + Intergenic
1200204245 X:154304413-154304435 CTTCAAAGGACACAAAAAGAGGG - Intronic