ID: 909363645

View in Genome Browser
Species Human (GRCh38)
Location 1:74794602-74794624
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909363645_909363648 30 Left 909363645 1:74794602-74794624 CCTCTTTTATAGACATAAGTGTC No data
Right 909363648 1:74794655-74794677 TTCCCCTCAGTTCTCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909363645 Original CRISPR GACACTTATGTCTATAAAAG AGG (reversed) Intergenic
No off target data available for this crispr