ID: 909368380

View in Genome Browser
Species Human (GRCh38)
Location 1:74855991-74856013
Sequence ATCTTTCCTGCTCTTTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909368376_909368380 28 Left 909368376 1:74855940-74855962 CCAGTCTACAAACTGATTATTAT No data
Right 909368380 1:74855991-74856013 ATCTTTCCTGCTCTTTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909368380 Original CRISPR ATCTTTCCTGCTCTTTCTTG TGG Intergenic
No off target data available for this crispr