ID: 909375910

View in Genome Browser
Species Human (GRCh38)
Location 1:74941725-74941747
Sequence CTGTAAATACAGAATTAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909375903_909375910 11 Left 909375903 1:74941691-74941713 CCGGCCTGACCAACATGGAGAAA 0: 18586
1: 36319
2: 134688
3: 174060
4: 144372
Right 909375910 1:74941725-74941747 CTGTAAATACAGAATTAGCCGGG No data
909375905_909375910 2 Left 909375905 1:74941700-74941722 CCAACATGGAGAAACCCCATCTC 0: 6989
1: 57841
2: 113035
3: 132150
4: 96142
Right 909375910 1:74941725-74941747 CTGTAAATACAGAATTAGCCGGG No data
909375904_909375910 7 Left 909375904 1:74941695-74941717 CCTGACCAACATGGAGAAACCCC 0: 12353
1: 30279
2: 108113
3: 178545
4: 183822
Right 909375910 1:74941725-74941747 CTGTAAATACAGAATTAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909375910 Original CRISPR CTGTAAATACAGAATTAGCC GGG Intergenic
No off target data available for this crispr