ID: 909382775

View in Genome Browser
Species Human (GRCh38)
Location 1:75018880-75018902
Sequence TAGGGACAAGTGACAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909382775_909382780 -4 Left 909382775 1:75018880-75018902 CCTTCCTCTGTCACTTGTCCCTA No data
Right 909382780 1:75018899-75018921 CCTAAGTTTCCTGGAAAATTAGG No data
909382775_909382782 14 Left 909382775 1:75018880-75018902 CCTTCCTCTGTCACTTGTCCCTA No data
Right 909382782 1:75018917-75018939 TTAGGTTGAATAACAATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909382775 Original CRISPR TAGGGACAAGTGACAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr