ID: 909382775 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:75018880-75018902 |
| Sequence | TAGGGACAAGTGACAGAGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 909382775_909382780 | -4 | Left | 909382775 | 1:75018880-75018902 | CCTTCCTCTGTCACTTGTCCCTA | No data | ||
| Right | 909382780 | 1:75018899-75018921 | CCTAAGTTTCCTGGAAAATTAGG | No data | ||||
| 909382775_909382782 | 14 | Left | 909382775 | 1:75018880-75018902 | CCTTCCTCTGTCACTTGTCCCTA | No data | ||
| Right | 909382782 | 1:75018917-75018939 | TTAGGTTGAATAACAATGATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 909382775 | Original CRISPR | TAGGGACAAGTGACAGAGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||