ID: 909384982

View in Genome Browser
Species Human (GRCh38)
Location 1:75044150-75044172
Sequence TCCGGCAGCCGACTTTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909384979_909384982 6 Left 909384979 1:75044121-75044143 CCAATAACATACAATGGAGCTCC No data
Right 909384982 1:75044150-75044172 TCCGGCAGCCGACTTTTCAGTGG No data
909384977_909384982 24 Left 909384977 1:75044103-75044125 CCTAAAAGCAGCAAATAACCAAT No data
Right 909384982 1:75044150-75044172 TCCGGCAGCCGACTTTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909384982 Original CRISPR TCCGGCAGCCGACTTTTCAG TGG Intergenic
No off target data available for this crispr